ID: 1067528157

View in Genome Browser
Species Human (GRCh38)
Location 10:47050794-47050816
Sequence AGAGTTCCATGCTAACAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067528151_1067528157 21 Left 1067528151 10:47050750-47050772 CCTGCTGCTGGCTCCAAGGAAGC No data
Right 1067528157 10:47050794-47050816 AGAGTTCCATGCTAACAAAATGG No data
1067528153_1067528157 8 Left 1067528153 10:47050763-47050785 CCAAGGAAGCTGCTGAGATAGGG No data
Right 1067528157 10:47050794-47050816 AGAGTTCCATGCTAACAAAATGG No data
1067528149_1067528157 28 Left 1067528149 10:47050743-47050765 CCTCAGGCCTGCTGCTGGCTCCA No data
Right 1067528157 10:47050794-47050816 AGAGTTCCATGCTAACAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067528157 Original CRISPR AGAGTTCCATGCTAACAAAA TGG Intergenic
No off target data available for this crispr