ID: 1067531138

View in Genome Browser
Species Human (GRCh38)
Location 10:47074466-47074488
Sequence TGTCCTCTGCAAGATGTACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067531132_1067531138 16 Left 1067531132 10:47074427-47074449 CCTTTGCCATCCTGTATTTTTGG No data
Right 1067531138 10:47074466-47074488 TGTCCTCTGCAAGATGTACAAGG No data
1067531134_1067531138 10 Left 1067531134 10:47074433-47074455 CCATCCTGTATTTTTGGTAGAAA No data
Right 1067531138 10:47074466-47074488 TGTCCTCTGCAAGATGTACAAGG No data
1067531135_1067531138 6 Left 1067531135 10:47074437-47074459 CCTGTATTTTTGGTAGAAAGTCA No data
Right 1067531138 10:47074466-47074488 TGTCCTCTGCAAGATGTACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067531138 Original CRISPR TGTCCTCTGCAAGATGTACA AGG Intergenic
No off target data available for this crispr