ID: 1067531889

View in Genome Browser
Species Human (GRCh38)
Location 10:47080308-47080330
Sequence TCTCCTACCCACTGTGAGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067531889_1067531897 22 Left 1067531889 10:47080308-47080330 CCCAACTCACAGTGGGTAGGAGA No data
Right 1067531897 10:47080353-47080375 CAACAGGGTGCTCTAGTTCCTGG No data
1067531889_1067531896 7 Left 1067531889 10:47080308-47080330 CCCAACTCACAGTGGGTAGGAGA No data
Right 1067531896 10:47080338-47080360 ATGTTGCAATCTTCACAACAGGG No data
1067531889_1067531900 30 Left 1067531889 10:47080308-47080330 CCCAACTCACAGTGGGTAGGAGA No data
Right 1067531900 10:47080361-47080383 TGCTCTAGTTCCTGGATTAGGGG No data
1067531889_1067531899 29 Left 1067531889 10:47080308-47080330 CCCAACTCACAGTGGGTAGGAGA No data
Right 1067531899 10:47080360-47080382 GTGCTCTAGTTCCTGGATTAGGG No data
1067531889_1067531895 6 Left 1067531889 10:47080308-47080330 CCCAACTCACAGTGGGTAGGAGA No data
Right 1067531895 10:47080337-47080359 GATGTTGCAATCTTCACAACAGG No data
1067531889_1067531898 28 Left 1067531889 10:47080308-47080330 CCCAACTCACAGTGGGTAGGAGA No data
Right 1067531898 10:47080359-47080381 GGTGCTCTAGTTCCTGGATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067531889 Original CRISPR TCTCCTACCCACTGTGAGTT GGG (reversed) Intergenic
No off target data available for this crispr