ID: 1067533649

View in Genome Browser
Species Human (GRCh38)
Location 10:47092596-47092618
Sequence AGGGAGGCTGTCAGGGGTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067533649_1067533663 23 Left 1067533649 10:47092596-47092618 CCTACACCCCTGACAGCCTCCCT No data
Right 1067533663 10:47092642-47092664 GTGTACCTGCCAGGTAAGCTGGG No data
1067533649_1067533659 14 Left 1067533649 10:47092596-47092618 CCTACACCCCTGACAGCCTCCCT No data
Right 1067533659 10:47092633-47092655 TGCCCTTAAGTGTACCTGCCAGG No data
1067533649_1067533662 22 Left 1067533649 10:47092596-47092618 CCTACACCCCTGACAGCCTCCCT No data
Right 1067533662 10:47092641-47092663 AGTGTACCTGCCAGGTAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067533649 Original CRISPR AGGGAGGCTGTCAGGGGTGT AGG (reversed) Intergenic
No off target data available for this crispr