ID: 1067533652

View in Genome Browser
Species Human (GRCh38)
Location 10:47092603-47092625
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067533652_1067533666 25 Left 1067533652 10:47092603-47092625 CCCTGACAGCCTCCCTCAGTGGC No data
Right 1067533666 10:47092651-47092673 CCAGGTAAGCTGGGTGACTCTGG No data
1067533652_1067533662 15 Left 1067533652 10:47092603-47092625 CCCTGACAGCCTCCCTCAGTGGC No data
Right 1067533662 10:47092641-47092663 AGTGTACCTGCCAGGTAAGCTGG No data
1067533652_1067533663 16 Left 1067533652 10:47092603-47092625 CCCTGACAGCCTCCCTCAGTGGC No data
Right 1067533663 10:47092642-47092664 GTGTACCTGCCAGGTAAGCTGGG No data
1067533652_1067533659 7 Left 1067533652 10:47092603-47092625 CCCTGACAGCCTCCCTCAGTGGC No data
Right 1067533659 10:47092633-47092655 TGCCCTTAAGTGTACCTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067533652 Original CRISPR GCCACTGAGGGAGGCTGTCA GGG (reversed) Intergenic
No off target data available for this crispr