ID: 1067533658

View in Genome Browser
Species Human (GRCh38)
Location 10:47092626-47092648
Sequence GGTACACTTAAGGGCATCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067533658_1067533668 14 Left 1067533658 10:47092626-47092648 CCTCTGATGCCCTTAAGTGTACC No data
Right 1067533668 10:47092663-47092685 GGTGACTCTGGCCTCTTGCCGGG No data
1067533658_1067533662 -8 Left 1067533658 10:47092626-47092648 CCTCTGATGCCCTTAAGTGTACC No data
Right 1067533662 10:47092641-47092663 AGTGTACCTGCCAGGTAAGCTGG No data
1067533658_1067533667 13 Left 1067533658 10:47092626-47092648 CCTCTGATGCCCTTAAGTGTACC No data
Right 1067533667 10:47092662-47092684 GGGTGACTCTGGCCTCTTGCCGG No data
1067533658_1067533666 2 Left 1067533658 10:47092626-47092648 CCTCTGATGCCCTTAAGTGTACC No data
Right 1067533666 10:47092651-47092673 CCAGGTAAGCTGGGTGACTCTGG No data
1067533658_1067533663 -7 Left 1067533658 10:47092626-47092648 CCTCTGATGCCCTTAAGTGTACC No data
Right 1067533663 10:47092642-47092664 GTGTACCTGCCAGGTAAGCTGGG No data
1067533658_1067533669 15 Left 1067533658 10:47092626-47092648 CCTCTGATGCCCTTAAGTGTACC No data
Right 1067533669 10:47092664-47092686 GTGACTCTGGCCTCTTGCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067533658 Original CRISPR GGTACACTTAAGGGCATCAG AGG (reversed) Intergenic
No off target data available for this crispr