ID: 1067533663

View in Genome Browser
Species Human (GRCh38)
Location 10:47092642-47092664
Sequence GTGTACCTGCCAGGTAAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067533653_1067533663 15 Left 1067533653 10:47092604-47092626 CCTGACAGCCTCCCTCAGTGGCC No data
Right 1067533663 10:47092642-47092664 GTGTACCTGCCAGGTAAGCTGGG No data
1067533655_1067533663 4 Left 1067533655 10:47092615-47092637 CCCTCAGTGGCCCTCTGATGCCC No data
Right 1067533663 10:47092642-47092664 GTGTACCTGCCAGGTAAGCTGGG No data
1067533656_1067533663 3 Left 1067533656 10:47092616-47092638 CCTCAGTGGCCCTCTGATGCCCT No data
Right 1067533663 10:47092642-47092664 GTGTACCTGCCAGGTAAGCTGGG No data
1067533654_1067533663 7 Left 1067533654 10:47092612-47092634 CCTCCCTCAGTGGCCCTCTGATG No data
Right 1067533663 10:47092642-47092664 GTGTACCTGCCAGGTAAGCTGGG No data
1067533652_1067533663 16 Left 1067533652 10:47092603-47092625 CCCTGACAGCCTCCCTCAGTGGC No data
Right 1067533663 10:47092642-47092664 GTGTACCTGCCAGGTAAGCTGGG No data
1067533648_1067533663 27 Left 1067533648 10:47092592-47092614 CCTGCCTACACCCCTGACAGCCT No data
Right 1067533663 10:47092642-47092664 GTGTACCTGCCAGGTAAGCTGGG No data
1067533650_1067533663 17 Left 1067533650 10:47092602-47092624 CCCCTGACAGCCTCCCTCAGTGG No data
Right 1067533663 10:47092642-47092664 GTGTACCTGCCAGGTAAGCTGGG No data
1067533658_1067533663 -7 Left 1067533658 10:47092626-47092648 CCTCTGATGCCCTTAAGTGTACC No data
Right 1067533663 10:47092642-47092664 GTGTACCTGCCAGGTAAGCTGGG No data
1067533649_1067533663 23 Left 1067533649 10:47092596-47092618 CCTACACCCCTGACAGCCTCCCT No data
Right 1067533663 10:47092642-47092664 GTGTACCTGCCAGGTAAGCTGGG No data
1067533657_1067533663 -6 Left 1067533657 10:47092625-47092647 CCCTCTGATGCCCTTAAGTGTAC No data
Right 1067533663 10:47092642-47092664 GTGTACCTGCCAGGTAAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067533663 Original CRISPR GTGTACCTGCCAGGTAAGCT GGG Intergenic
No off target data available for this crispr