ID: 1067533667

View in Genome Browser
Species Human (GRCh38)
Location 10:47092662-47092684
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067533661_1067533667 3 Left 1067533661 10:47092636-47092658 CCTTAAGTGTACCTGCCAGGTAA No data
Right 1067533667 10:47092662-47092684 GGGTGACTCTGGCCTCTTGCCGG No data
1067533655_1067533667 24 Left 1067533655 10:47092615-47092637 CCCTCAGTGGCCCTCTGATGCCC No data
Right 1067533667 10:47092662-47092684 GGGTGACTCTGGCCTCTTGCCGG No data
1067533658_1067533667 13 Left 1067533658 10:47092626-47092648 CCTCTGATGCCCTTAAGTGTACC No data
Right 1067533667 10:47092662-47092684 GGGTGACTCTGGCCTCTTGCCGG No data
1067533657_1067533667 14 Left 1067533657 10:47092625-47092647 CCCTCTGATGCCCTTAAGTGTAC No data
Right 1067533667 10:47092662-47092684 GGGTGACTCTGGCCTCTTGCCGG No data
1067533654_1067533667 27 Left 1067533654 10:47092612-47092634 CCTCCCTCAGTGGCCCTCTGATG No data
Right 1067533667 10:47092662-47092684 GGGTGACTCTGGCCTCTTGCCGG No data
1067533656_1067533667 23 Left 1067533656 10:47092616-47092638 CCTCAGTGGCCCTCTGATGCCCT No data
Right 1067533667 10:47092662-47092684 GGGTGACTCTGGCCTCTTGCCGG No data
1067533664_1067533667 -8 Left 1067533664 10:47092647-47092669 CCTGCCAGGTAAGCTGGGTGACT No data
Right 1067533667 10:47092662-47092684 GGGTGACTCTGGCCTCTTGCCGG No data
1067533660_1067533667 4 Left 1067533660 10:47092635-47092657 CCCTTAAGTGTACCTGCCAGGTA No data
Right 1067533667 10:47092662-47092684 GGGTGACTCTGGCCTCTTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067533667 Original CRISPR GGGTGACTCTGGCCTCTTGC CGG Intergenic
No off target data available for this crispr