ID: 1067534143

View in Genome Browser
Species Human (GRCh38)
Location 10:47095629-47095651
Sequence CAACAGCCCAGTACCACCTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067534143_1067534147 -1 Left 1067534143 10:47095629-47095651 CCGGAGGTGGTACTGGGCTGTTG No data
Right 1067534147 10:47095651-47095673 GGATGTGGAGAGGTCCCCTCAGG No data
1067534143_1067534154 17 Left 1067534143 10:47095629-47095651 CCGGAGGTGGTACTGGGCTGTTG No data
Right 1067534154 10:47095669-47095691 TCAGGTCAGCCGGGAAGGCTTGG No data
1067534143_1067534148 7 Left 1067534143 10:47095629-47095651 CCGGAGGTGGTACTGGGCTGTTG No data
Right 1067534148 10:47095659-47095681 AGAGGTCCCCTCAGGTCAGCCGG No data
1067534143_1067534158 30 Left 1067534143 10:47095629-47095651 CCGGAGGTGGTACTGGGCTGTTG No data
Right 1067534158 10:47095682-47095704 GAAGGCTTGGGAAGGATAACCGG No data
1067534143_1067534156 22 Left 1067534143 10:47095629-47095651 CCGGAGGTGGTACTGGGCTGTTG No data
Right 1067534156 10:47095674-47095696 TCAGCCGGGAAGGCTTGGGAAGG No data
1067534143_1067534149 8 Left 1067534143 10:47095629-47095651 CCGGAGGTGGTACTGGGCTGTTG No data
Right 1067534149 10:47095660-47095682 GAGGTCCCCTCAGGTCAGCCGGG No data
1067534143_1067534155 18 Left 1067534143 10:47095629-47095651 CCGGAGGTGGTACTGGGCTGTTG No data
Right 1067534155 10:47095670-47095692 CAGGTCAGCCGGGAAGGCTTGGG No data
1067534143_1067534150 12 Left 1067534143 10:47095629-47095651 CCGGAGGTGGTACTGGGCTGTTG No data
Right 1067534150 10:47095664-47095686 TCCCCTCAGGTCAGCCGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067534143 Original CRISPR CAACAGCCCAGTACCACCTC CGG (reversed) Intergenic