ID: 1067534151

View in Genome Browser
Species Human (GRCh38)
Location 10:47095665-47095687
Sequence GCCTTCCCGGCTGACCTGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067534151_1067534159 1 Left 1067534151 10:47095665-47095687 CCCCTCAGGTCAGCCGGGAAGGC No data
Right 1067534159 10:47095689-47095711 TGGGAAGGATAACCGGCAGCTGG No data
1067534151_1067534158 -6 Left 1067534151 10:47095665-47095687 CCCCTCAGGTCAGCCGGGAAGGC No data
Right 1067534158 10:47095682-47095704 GAAGGCTTGGGAAGGATAACCGG No data
1067534151_1067534161 25 Left 1067534151 10:47095665-47095687 CCCCTCAGGTCAGCCGGGAAGGC No data
Right 1067534161 10:47095713-47095735 GACCTTTAACTCCCTTGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067534151 Original CRISPR GCCTTCCCGGCTGACCTGAG GGG (reversed) Intergenic