ID: 1067534153

View in Genome Browser
Species Human (GRCh38)
Location 10:47095667-47095689
Sequence AAGCCTTCCCGGCTGACCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067534153_1067534158 -8 Left 1067534153 10:47095667-47095689 CCTCAGGTCAGCCGGGAAGGCTT No data
Right 1067534158 10:47095682-47095704 GAAGGCTTGGGAAGGATAACCGG No data
1067534153_1067534159 -1 Left 1067534153 10:47095667-47095689 CCTCAGGTCAGCCGGGAAGGCTT No data
Right 1067534159 10:47095689-47095711 TGGGAAGGATAACCGGCAGCTGG No data
1067534153_1067534161 23 Left 1067534153 10:47095667-47095689 CCTCAGGTCAGCCGGGAAGGCTT No data
Right 1067534161 10:47095713-47095735 GACCTTTAACTCCCTTGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067534153 Original CRISPR AAGCCTTCCCGGCTGACCTG AGG (reversed) Intergenic