ID: 1067534158

View in Genome Browser
Species Human (GRCh38)
Location 10:47095682-47095704
Sequence GAAGGCTTGGGAAGGATAAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067534143_1067534158 30 Left 1067534143 10:47095629-47095651 CCGGAGGTGGTACTGGGCTGTTG No data
Right 1067534158 10:47095682-47095704 GAAGGCTTGGGAAGGATAACCGG No data
1067534151_1067534158 -6 Left 1067534151 10:47095665-47095687 CCCCTCAGGTCAGCCGGGAAGGC No data
Right 1067534158 10:47095682-47095704 GAAGGCTTGGGAAGGATAACCGG No data
1067534152_1067534158 -7 Left 1067534152 10:47095666-47095688 CCCTCAGGTCAGCCGGGAAGGCT No data
Right 1067534158 10:47095682-47095704 GAAGGCTTGGGAAGGATAACCGG No data
1067534153_1067534158 -8 Left 1067534153 10:47095667-47095689 CCTCAGGTCAGCCGGGAAGGCTT No data
Right 1067534158 10:47095682-47095704 GAAGGCTTGGGAAGGATAACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067534158 Original CRISPR GAAGGCTTGGGAAGGATAAC CGG Intergenic