ID: 1067534159

View in Genome Browser
Species Human (GRCh38)
Location 10:47095689-47095711
Sequence TGGGAAGGATAACCGGCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067534152_1067534159 0 Left 1067534152 10:47095666-47095688 CCCTCAGGTCAGCCGGGAAGGCT No data
Right 1067534159 10:47095689-47095711 TGGGAAGGATAACCGGCAGCTGG No data
1067534153_1067534159 -1 Left 1067534153 10:47095667-47095689 CCTCAGGTCAGCCGGGAAGGCTT No data
Right 1067534159 10:47095689-47095711 TGGGAAGGATAACCGGCAGCTGG No data
1067534151_1067534159 1 Left 1067534151 10:47095665-47095687 CCCCTCAGGTCAGCCGGGAAGGC No data
Right 1067534159 10:47095689-47095711 TGGGAAGGATAACCGGCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067534159 Original CRISPR TGGGAAGGATAACCGGCAGC TGG Intergenic
No off target data available for this crispr