ID: 1067534161

View in Genome Browser
Species Human (GRCh38)
Location 10:47095713-47095735
Sequence GACCTTTAACTCCCTTGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067534157_1067534161 12 Left 1067534157 10:47095678-47095700 CCGGGAAGGCTTGGGAAGGATAA No data
Right 1067534161 10:47095713-47095735 GACCTTTAACTCCCTTGTCCTGG No data
1067534152_1067534161 24 Left 1067534152 10:47095666-47095688 CCCTCAGGTCAGCCGGGAAGGCT No data
Right 1067534161 10:47095713-47095735 GACCTTTAACTCCCTTGTCCTGG No data
1067534151_1067534161 25 Left 1067534151 10:47095665-47095687 CCCCTCAGGTCAGCCGGGAAGGC No data
Right 1067534161 10:47095713-47095735 GACCTTTAACTCCCTTGTCCTGG No data
1067534153_1067534161 23 Left 1067534153 10:47095667-47095689 CCTCAGGTCAGCCGGGAAGGCTT No data
Right 1067534161 10:47095713-47095735 GACCTTTAACTCCCTTGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067534161 Original CRISPR GACCTTTAACTCCCTTGTCC TGG Intergenic