ID: 1067535552

View in Genome Browser
Species Human (GRCh38)
Location 10:47107327-47107349
Sequence ATGGAGAAGCCCAACCAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067535548_1067535552 -6 Left 1067535548 10:47107310-47107332 CCATGTAGCCAGCTGCAATGGAG No data
Right 1067535552 10:47107327-47107349 ATGGAGAAGCCCAACCAGGGAGG No data
1067535545_1067535552 12 Left 1067535545 10:47107292-47107314 CCTTCCTAGAACTTGAATCCATG No data
Right 1067535552 10:47107327-47107349 ATGGAGAAGCCCAACCAGGGAGG No data
1067535546_1067535552 8 Left 1067535546 10:47107296-47107318 CCTAGAACTTGAATCCATGTAGC No data
Right 1067535552 10:47107327-47107349 ATGGAGAAGCCCAACCAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067535552 Original CRISPR ATGGAGAAGCCCAACCAGGG AGG Intergenic
No off target data available for this crispr