ID: 1067537320

View in Genome Browser
Species Human (GRCh38)
Location 10:47122894-47122916
Sequence CTGTCTATGAAAAAGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067537314_1067537320 13 Left 1067537314 10:47122858-47122880 CCCTTTCCACCATGTGAGGTTAT No data
Right 1067537320 10:47122894-47122916 CTGTCTATGAAAAAGGAGGCAGG No data
1067537310_1067537320 27 Left 1067537310 10:47122844-47122866 CCACAGAACTCACCCCCTTTCCA No data
Right 1067537320 10:47122894-47122916 CTGTCTATGAAAAAGGAGGCAGG No data
1067537308_1067537320 29 Left 1067537308 10:47122842-47122864 CCCCACAGAACTCACCCCCTTTC No data
Right 1067537320 10:47122894-47122916 CTGTCTATGAAAAAGGAGGCAGG No data
1067537313_1067537320 14 Left 1067537313 10:47122857-47122879 CCCCTTTCCACCATGTGAGGTTA No data
Right 1067537320 10:47122894-47122916 CTGTCTATGAAAAAGGAGGCAGG No data
1067537312_1067537320 15 Left 1067537312 10:47122856-47122878 CCCCCTTTCCACCATGTGAGGTT No data
Right 1067537320 10:47122894-47122916 CTGTCTATGAAAAAGGAGGCAGG No data
1067537316_1067537320 7 Left 1067537316 10:47122864-47122886 CCACCATGTGAGGTTATAGCAAG No data
Right 1067537320 10:47122894-47122916 CTGTCTATGAAAAAGGAGGCAGG No data
1067537309_1067537320 28 Left 1067537309 10:47122843-47122865 CCCACAGAACTCACCCCCTTTCC No data
Right 1067537320 10:47122894-47122916 CTGTCTATGAAAAAGGAGGCAGG No data
1067537315_1067537320 12 Left 1067537315 10:47122859-47122881 CCTTTCCACCATGTGAGGTTATA 0: 3
1: 23
2: 115
3: 591
4: 1382
Right 1067537320 10:47122894-47122916 CTGTCTATGAAAAAGGAGGCAGG No data
1067537317_1067537320 4 Left 1067537317 10:47122867-47122889 CCATGTGAGGTTATAGCAAGAAG No data
Right 1067537320 10:47122894-47122916 CTGTCTATGAAAAAGGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067537320 Original CRISPR CTGTCTATGAAAAAGGAGGC AGG Intergenic
No off target data available for this crispr