ID: 1067539057

View in Genome Browser
Species Human (GRCh38)
Location 10:47138400-47138422
Sequence CTCCTCTTCCAGAAGGGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067539057_1067539066 27 Left 1067539057 10:47138400-47138422 CCTTGGCCCTTCTGGAAGAGGAG No data
Right 1067539066 10:47138450-47138472 CCCAGCCCCATGACCACACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067539057 Original CRISPR CTCCTCTTCCAGAAGGGCCA AGG (reversed) Intergenic
No off target data available for this crispr