ID: 1067544601

View in Genome Browser
Species Human (GRCh38)
Location 10:47183939-47183961
Sequence CTCTGTGGTTGGAGGGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067544590_1067544601 8 Left 1067544590 10:47183908-47183930 CCAAGGAGCCAGGGGCAAACTGG No data
Right 1067544601 10:47183939-47183961 CTCTGTGGTTGGAGGGCAGAGGG No data
1067544594_1067544601 0 Left 1067544594 10:47183916-47183938 CCAGGGGCAAACTGGGGCAGCAC No data
Right 1067544601 10:47183939-47183961 CTCTGTGGTTGGAGGGCAGAGGG No data
1067544584_1067544601 21 Left 1067544584 10:47183895-47183917 CCTCTCCCTGGAGCCAAGGAGCC No data
Right 1067544601 10:47183939-47183961 CTCTGTGGTTGGAGGGCAGAGGG No data
1067544587_1067544601 16 Left 1067544587 10:47183900-47183922 CCCTGGAGCCAAGGAGCCAGGGG No data
Right 1067544601 10:47183939-47183961 CTCTGTGGTTGGAGGGCAGAGGG No data
1067544589_1067544601 15 Left 1067544589 10:47183901-47183923 CCTGGAGCCAAGGAGCCAGGGGC No data
Right 1067544601 10:47183939-47183961 CTCTGTGGTTGGAGGGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067544601 Original CRISPR CTCTGTGGTTGGAGGGCAGA GGG Intergenic
No off target data available for this crispr