ID: 1067545179

View in Genome Browser
Species Human (GRCh38)
Location 10:47187792-47187814
Sequence GACCAGGCCCACTTCACCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067545179_1067545186 19 Left 1067545179 10:47187792-47187814 CCCCAGGTGAAGTGGGCCTGGTC No data
Right 1067545186 10:47187834-47187856 ATCACCTCTTCTGAGAGCCTTGG No data
1067545179_1067545182 -10 Left 1067545179 10:47187792-47187814 CCCCAGGTGAAGTGGGCCTGGTC No data
Right 1067545182 10:47187805-47187827 GGGCCTGGTCAGACACCATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067545179 Original CRISPR GACCAGGCCCACTTCACCTG GGG (reversed) Intergenic
No off target data available for this crispr