ID: 1067546972

View in Genome Browser
Species Human (GRCh38)
Location 10:47199141-47199163
Sequence ATCAAGAAACAGTCTGATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067546972_1067546973 8 Left 1067546972 10:47199141-47199163 CCAAAATCAGACTGTTTCTTGAT No data
Right 1067546973 10:47199172-47199194 AAAACTAAAAGAAAAACATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067546972 Original CRISPR ATCAAGAAACAGTCTGATTT TGG (reversed) Intergenic
No off target data available for this crispr