ID: 1067547384

View in Genome Browser
Species Human (GRCh38)
Location 10:47203598-47203620
Sequence ACTTACATGCTGTTGGTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067547384_1067547386 15 Left 1067547384 10:47203598-47203620 CCTTGCACCAACAGCATGTAAGT No data
Right 1067547386 10:47203636-47203658 CAAATCCTCCAGCTCCACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067547384 Original CRISPR ACTTACATGCTGTTGGTGCA AGG (reversed) Intergenic
No off target data available for this crispr