ID: 1067547423

View in Genome Browser
Species Human (GRCh38)
Location 10:47203937-47203959
Sequence AATGACTCCTTGGCCAATTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067547423_1067547428 -1 Left 1067547423 10:47203937-47203959 CCGGAATTGGCCAAGGAGTCATT No data
Right 1067547428 10:47203959-47203981 TTCAGATTGCTAGGGGCCACAGG No data
1067547423_1067547430 18 Left 1067547423 10:47203937-47203959 CCGGAATTGGCCAAGGAGTCATT No data
Right 1067547430 10:47203978-47204000 CAGGCTCCTCCCACGCACTCAGG No data
1067547423_1067547425 -10 Left 1067547423 10:47203937-47203959 CCGGAATTGGCCAAGGAGTCATT No data
Right 1067547425 10:47203950-47203972 AGGAGTCATTTCAGATTGCTAGG No data
1067547423_1067547427 -8 Left 1067547423 10:47203937-47203959 CCGGAATTGGCCAAGGAGTCATT No data
Right 1067547427 10:47203952-47203974 GAGTCATTTCAGATTGCTAGGGG No data
1067547423_1067547432 26 Left 1067547423 10:47203937-47203959 CCGGAATTGGCCAAGGAGTCATT No data
Right 1067547432 10:47203986-47204008 TCCCACGCACTCAGGCAGAGAGG No data
1067547423_1067547426 -9 Left 1067547423 10:47203937-47203959 CCGGAATTGGCCAAGGAGTCATT No data
Right 1067547426 10:47203951-47203973 GGAGTCATTTCAGATTGCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067547423 Original CRISPR AATGACTCCTTGGCCAATTC CGG (reversed) Intergenic
No off target data available for this crispr