ID: 1067549429

View in Genome Browser
Species Human (GRCh38)
Location 10:47223447-47223469
Sequence CCCTGGGAGATGCCTACCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067549429_1067549431 -8 Left 1067549429 10:47223447-47223469 CCTATGGTAGGCATCTCCCAGGG No data
Right 1067549431 10:47223462-47223484 TCCCAGGGCTGCCATCTCCCAGG No data
1067549429_1067549433 -7 Left 1067549429 10:47223447-47223469 CCTATGGTAGGCATCTCCCAGGG No data
Right 1067549433 10:47223463-47223485 CCCAGGGCTGCCATCTCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067549429 Original CRISPR CCCTGGGAGATGCCTACCAT AGG (reversed) Intergenic
No off target data available for this crispr