ID: 1067551189

View in Genome Browser
Species Human (GRCh38)
Location 10:47237645-47237667
Sequence AGGTGGGCTCCAGTATGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067551189_1067551197 10 Left 1067551189 10:47237645-47237667 CCAGGCCATACTGGAGCCCACCT No data
Right 1067551197 10:47237678-47237700 CTCTCCCTGGTGTTGACTTAGGG No data
1067551189_1067551195 -3 Left 1067551189 10:47237645-47237667 CCAGGCCATACTGGAGCCCACCT No data
Right 1067551195 10:47237665-47237687 CCTTGTGCGGTGACTCTCCCTGG No data
1067551189_1067551196 9 Left 1067551189 10:47237645-47237667 CCAGGCCATACTGGAGCCCACCT No data
Right 1067551196 10:47237677-47237699 ACTCTCCCTGGTGTTGACTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067551189 Original CRISPR AGGTGGGCTCCAGTATGGCC TGG (reversed) Intergenic
No off target data available for this crispr