ID: 1067551404

View in Genome Browser
Species Human (GRCh38)
Location 10:47238844-47238866
Sequence GTATTAATGTGCCCTGTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067551404_1067551414 18 Left 1067551404 10:47238844-47238866 CCTGGGACAGGGCACATTAATAC No data
Right 1067551414 10:47238885-47238907 GAGGATGGGTGGGCTTGAGCTGG No data
1067551404_1067551410 4 Left 1067551404 10:47238844-47238866 CCTGGGACAGGGCACATTAATAC No data
Right 1067551410 10:47238871-47238893 AGGGTGTCACCTGCGAGGATGGG No data
1067551404_1067551409 3 Left 1067551404 10:47238844-47238866 CCTGGGACAGGGCACATTAATAC No data
Right 1067551409 10:47238870-47238892 GAGGGTGTCACCTGCGAGGATGG No data
1067551404_1067551417 27 Left 1067551404 10:47238844-47238866 CCTGGGACAGGGCACATTAATAC No data
Right 1067551417 10:47238894-47238916 TGGGCTTGAGCTGGGGCAAATGG No data
1067551404_1067551411 7 Left 1067551404 10:47238844-47238866 CCTGGGACAGGGCACATTAATAC No data
Right 1067551411 10:47238874-47238896 GTGTCACCTGCGAGGATGGGTGG No data
1067551404_1067551408 -1 Left 1067551404 10:47238844-47238866 CCTGGGACAGGGCACATTAATAC No data
Right 1067551408 10:47238866-47238888 CATGGAGGGTGTCACCTGCGAGG No data
1067551404_1067551412 8 Left 1067551404 10:47238844-47238866 CCTGGGACAGGGCACATTAATAC No data
Right 1067551412 10:47238875-47238897 TGTCACCTGCGAGGATGGGTGGG No data
1067551404_1067551415 19 Left 1067551404 10:47238844-47238866 CCTGGGACAGGGCACATTAATAC No data
Right 1067551415 10:47238886-47238908 AGGATGGGTGGGCTTGAGCTGGG No data
1067551404_1067551416 20 Left 1067551404 10:47238844-47238866 CCTGGGACAGGGCACATTAATAC No data
Right 1067551416 10:47238887-47238909 GGATGGGTGGGCTTGAGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067551404 Original CRISPR GTATTAATGTGCCCTGTCCC AGG (reversed) Intergenic
No off target data available for this crispr