ID: 1067551409

View in Genome Browser
Species Human (GRCh38)
Location 10:47238870-47238892
Sequence GAGGGTGTCACCTGCGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067551404_1067551409 3 Left 1067551404 10:47238844-47238866 CCTGGGACAGGGCACATTAATAC No data
Right 1067551409 10:47238870-47238892 GAGGGTGTCACCTGCGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067551409 Original CRISPR GAGGGTGTCACCTGCGAGGA TGG Intergenic
No off target data available for this crispr