ID: 1067552416

View in Genome Browser
Species Human (GRCh38)
Location 10:47245149-47245171
Sequence CCACCCCACCAGAGGGCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067552416_1067552434 15 Left 1067552416 10:47245149-47245171 CCCTGTGCCCTCTGGTGGGGTGG No data
Right 1067552434 10:47245187-47245209 GTGGGGGGAGGCTCAGCAGCTGG No data
1067552416_1067552427 -7 Left 1067552416 10:47245149-47245171 CCCTGTGCCCTCTGGTGGGGTGG No data
Right 1067552427 10:47245165-47245187 GGGGTGGCAGGGGGAGGGTGCGG No data
1067552416_1067552429 -3 Left 1067552416 10:47245149-47245171 CCCTGTGCCCTCTGGTGGGGTGG No data
Right 1067552429 10:47245169-47245191 TGGCAGGGGGAGGGTGCGGTGGG No data
1067552416_1067552435 23 Left 1067552416 10:47245149-47245171 CCCTGTGCCCTCTGGTGGGGTGG No data
Right 1067552435 10:47245195-47245217 AGGCTCAGCAGCTGGAGCACAGG No data
1067552416_1067552432 0 Left 1067552416 10:47245149-47245171 CCCTGTGCCCTCTGGTGGGGTGG No data
Right 1067552432 10:47245172-47245194 CAGGGGGAGGGTGCGGTGGGGGG No data
1067552416_1067552433 3 Left 1067552416 10:47245149-47245171 CCCTGTGCCCTCTGGTGGGGTGG No data
Right 1067552433 10:47245175-47245197 GGGGAGGGTGCGGTGGGGGGAGG No data
1067552416_1067552428 -4 Left 1067552416 10:47245149-47245171 CCCTGTGCCCTCTGGTGGGGTGG No data
Right 1067552428 10:47245168-47245190 GTGGCAGGGGGAGGGTGCGGTGG No data
1067552416_1067552430 -2 Left 1067552416 10:47245149-47245171 CCCTGTGCCCTCTGGTGGGGTGG No data
Right 1067552430 10:47245170-47245192 GGCAGGGGGAGGGTGCGGTGGGG No data
1067552416_1067552431 -1 Left 1067552416 10:47245149-47245171 CCCTGTGCCCTCTGGTGGGGTGG No data
Right 1067552431 10:47245171-47245193 GCAGGGGGAGGGTGCGGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067552416 Original CRISPR CCACCCCACCAGAGGGCACA GGG (reversed) Intergenic
No off target data available for this crispr