ID: 1067552837

View in Genome Browser
Species Human (GRCh38)
Location 10:47247319-47247341
Sequence AGGCACCCAGCAGTGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067552828_1067552837 19 Left 1067552828 10:47247277-47247299 CCTGTCCTGGAAGGTCAGGGATA No data
Right 1067552837 10:47247319-47247341 AGGCACCCAGCAGTGGAGGAGGG No data
1067552831_1067552837 14 Left 1067552831 10:47247282-47247304 CCTGGAAGGTCAGGGATAGGGCT No data
Right 1067552837 10:47247319-47247341 AGGCACCCAGCAGTGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067552837 Original CRISPR AGGCACCCAGCAGTGGAGGA GGG Intergenic
No off target data available for this crispr