ID: 1067552938

View in Genome Browser
Species Human (GRCh38)
Location 10:47247848-47247870
Sequence CCTGAGGGGCAGAGGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067552928_1067552938 10 Left 1067552928 10:47247815-47247837 CCCAGTTCAGTGAGCAAAGGGTT No data
Right 1067552938 10:47247848-47247870 CCTGAGGGGCAGAGGGAGGCAGG No data
1067552929_1067552938 9 Left 1067552929 10:47247816-47247838 CCAGTTCAGTGAGCAAAGGGTTC No data
Right 1067552938 10:47247848-47247870 CCTGAGGGGCAGAGGGAGGCAGG No data
1067552925_1067552938 23 Left 1067552925 10:47247802-47247824 CCAGTTCTGCAGGCCCAGTTCAG No data
Right 1067552938 10:47247848-47247870 CCTGAGGGGCAGAGGGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067552938 Original CRISPR CCTGAGGGGCAGAGGGAGGC AGG Intergenic
No off target data available for this crispr