ID: 1067555022

View in Genome Browser
Species Human (GRCh38)
Location 10:47263367-47263389
Sequence CCTAATCAGCACCAGCTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067555017_1067555022 20 Left 1067555017 10:47263324-47263346 CCCCATAGTTAGTAGGAAGAGAA No data
Right 1067555022 10:47263367-47263389 CCTAATCAGCACCAGCTGCAAGG No data
1067555020_1067555022 -5 Left 1067555020 10:47263349-47263371 CCATGCTGTCAACGCTCTCCTAA No data
Right 1067555022 10:47263367-47263389 CCTAATCAGCACCAGCTGCAAGG No data
1067555019_1067555022 18 Left 1067555019 10:47263326-47263348 CCATAGTTAGTAGGAAGAGAAAA No data
Right 1067555022 10:47263367-47263389 CCTAATCAGCACCAGCTGCAAGG No data
1067555016_1067555022 24 Left 1067555016 10:47263320-47263342 CCAACCCCATAGTTAGTAGGAAG No data
Right 1067555022 10:47263367-47263389 CCTAATCAGCACCAGCTGCAAGG No data
1067555018_1067555022 19 Left 1067555018 10:47263325-47263347 CCCATAGTTAGTAGGAAGAGAAA No data
Right 1067555022 10:47263367-47263389 CCTAATCAGCACCAGCTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067555022 Original CRISPR CCTAATCAGCACCAGCTGCA AGG Intergenic
No off target data available for this crispr