ID: 1067555753

View in Genome Browser
Species Human (GRCh38)
Location 10:47268869-47268891
Sequence GATGTAGCTGCCAGGCTTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067555753_1067555757 1 Left 1067555753 10:47268869-47268891 CCCTTAAGCCTGGCAGCTACATC No data
Right 1067555757 10:47268893-47268915 GCCCCTCCCCCAAGAGGAGATGG No data
1067555753_1067555756 -5 Left 1067555753 10:47268869-47268891 CCCTTAAGCCTGGCAGCTACATC No data
Right 1067555756 10:47268887-47268909 ACATCTGCCCCTCCCCCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067555753 Original CRISPR GATGTAGCTGCCAGGCTTAA GGG (reversed) Intergenic
No off target data available for this crispr