ID: 1067557514

View in Genome Browser
Species Human (GRCh38)
Location 10:47283064-47283086
Sequence TGTTCATTGCTAAAACTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067557509_1067557514 7 Left 1067557509 10:47283034-47283056 CCAGGACTGAGGGTTTCCTGAAA No data
Right 1067557514 10:47283064-47283086 TGTTCATTGCTAAAACTGGGAGG No data
1067557507_1067557514 14 Left 1067557507 10:47283027-47283049 CCTTAGCCCAGGACTGAGGGTTT No data
Right 1067557514 10:47283064-47283086 TGTTCATTGCTAAAACTGGGAGG No data
1067557511_1067557514 -9 Left 1067557511 10:47283050-47283072 CCTGAAATGCTGGATGTTCATTG No data
Right 1067557514 10:47283064-47283086 TGTTCATTGCTAAAACTGGGAGG No data
1067557508_1067557514 8 Left 1067557508 10:47283033-47283055 CCCAGGACTGAGGGTTTCCTGAA No data
Right 1067557514 10:47283064-47283086 TGTTCATTGCTAAAACTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067557514 Original CRISPR TGTTCATTGCTAAAACTGGG AGG Intergenic
No off target data available for this crispr