ID: 1067559943

View in Genome Browser
Species Human (GRCh38)
Location 10:47298315-47298337
Sequence CGCAGGAGGCCCGCACAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067559943_1067559947 0 Left 1067559943 10:47298315-47298337 CCAGCTTGTGCGGGCCTCCTGCG No data
Right 1067559947 10:47298338-47298360 GACTCACCCTCCTTTTCAACAGG No data
1067559943_1067559951 16 Left 1067559943 10:47298315-47298337 CCAGCTTGTGCGGGCCTCCTGCG No data
Right 1067559951 10:47298354-47298376 CAACAGGCCTCGATTGTGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067559943 Original CRISPR CGCAGGAGGCCCGCACAAGC TGG (reversed) Intergenic
No off target data available for this crispr