ID: 1067561197

View in Genome Browser
Species Human (GRCh38)
Location 10:47305776-47305798
Sequence GTGACCAGGTCCACTTTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 105}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067561197 Original CRISPR GTGACCAGGTCCACTTTGCT GGG (reversed) Intronic
902127471 1:14228224-14228246 GTGACCATTACCACTTTGCCAGG + Intergenic
904578987 1:31525793-31525815 GAGGACAGGTCCCCTTTGCTTGG + Intergenic
909519884 1:76555509-76555531 ATGACCAGGTTCACTTTGTTTGG - Intronic
909976314 1:82049716-82049738 GGGAACAGGTGCAGTTTGCTTGG + Intergenic
912719148 1:112005088-112005110 CTGACCACCACCACTTTGCTTGG + Intergenic
916650698 1:166831789-166831811 CTGAACAGGTCCACATGGCTAGG - Intergenic
922726019 1:227923428-227923450 GTGCCCAGGTCCACATGTCTGGG - Intronic
924546551 1:245033166-245033188 GTCACCAGGTCCAGTTGGGTTGG - Intronic
1063971676 10:11385498-11385520 CTAACCTGGTCCACTTTGCCAGG - Intergenic
1067561197 10:47305776-47305798 GTGACCAGGTCCACTTTGCTGGG - Intronic
1068749114 10:60571074-60571096 GAGACCAGTGCCACTATGCTAGG + Intronic
1069012142 10:63386285-63386307 CTGGGCAGGTGCACTTTGCTAGG - Intronic
1072086147 10:92081207-92081229 GTGACCAGCTCTACCTTGCATGG - Intronic
1085354739 11:75825795-75825817 GTGAACAGTTCCACTGTTCTTGG + Intronic
1090314250 11:125770954-125770976 CTGTCCAGGTCCTCTTTACTTGG - Intergenic
1091419239 12:320935-320957 GTGACATGGTCCACTGTTCTGGG - Intronic
1097775712 12:63642174-63642196 GTGACCAGGAGCACTGTTCTAGG - Intronic
1103927860 12:124433663-124433685 GTGCCTATGTCCACTGTGCTGGG + Intronic
1105299034 13:19116966-19116988 GTGGCCAGCTGCACTTGGCTGGG - Intergenic
1107451353 13:40512883-40512905 GTGACCAGTTCTATTTTACTGGG - Intergenic
1110636439 13:77772417-77772439 GATAACAGGTCTACTTTGCTAGG - Intergenic
1120119076 14:80656064-80656086 GTGACCAGATCCAGAATGCTGGG - Intronic
1122044409 14:99012886-99012908 GTGACCATGTGCCCTGTGCTCGG - Intergenic
1122764200 14:104054253-104054275 GAAACCTGGGCCACTTTGCTCGG - Intergenic
1123928784 15:25146561-25146583 TTGACCAGGTCCAGTTTTGTGGG - Intergenic
1134658001 16:15962122-15962144 GTGATCAGGCCCATGTTGCTTGG + Intronic
1137735828 16:50722452-50722474 GGAGGCAGGTCCACTTTGCTGGG + Intronic
1138651266 16:58463063-58463085 GGGACCAGGACACCTTTGCTAGG + Intronic
1139202249 16:64989831-64989853 TTGCCCAAGACCACTTTGCTTGG - Intronic
1141319900 16:82998070-82998092 GTGACCAGCTCAAATTTTCTAGG + Intronic
1141914428 16:87085358-87085380 TTGGCCAGGAGCACTTTGCTTGG - Intronic
1144354327 17:14429679-14429701 TTGACCAAGTCCATTTTTCTTGG + Intergenic
1144796860 17:17897464-17897486 GTCACCAGGTCAACTTCTCTGGG - Intronic
1145959776 17:28880637-28880659 GAGCCCAGGACCACTTTGCCTGG + Intronic
1153525764 18:5993085-5993107 GTCACCAGGGCCACCTTTCTTGG - Intronic
1157438205 18:47689308-47689330 TTCACCAGCTCCACTTTGCCTGG + Intergenic
1159396533 18:67865217-67865239 GTTACCAAGTCCACATGGCTTGG + Intergenic
1159838164 18:73366096-73366118 GTCTTCAGCTCCACTTTGCTAGG + Intergenic
1164325494 19:24187785-24187807 GTCACCAGGTCCACTGTGGACGG + Intergenic
1164991945 19:32691256-32691278 TTGACGAGTTCCACTTTGATGGG - Intergenic
1168153877 19:54462769-54462791 GCCACCAGGACCACATTGCTGGG - Exonic
1168235697 19:55061887-55061909 GTGGCCAGATCCCCTTTGGTCGG + Intronic
926415179 2:12642724-12642746 GTGAGAATGCCCACTTTGCTGGG + Intergenic
927498482 2:23565965-23565987 GTGACCAGGCCCACAGGGCTGGG - Intronic
929793283 2:45039164-45039186 GTGACAAGCCCCACTTTTCTAGG - Intergenic
929995890 2:46825990-46826012 GTGCACAGGCCCACTTTGGTGGG + Intronic
932233734 2:70104094-70104116 GTGACTAGGCCCAGTTAGCTGGG + Intergenic
932493007 2:72133388-72133410 GTGCCCAGGTCATCTGTGCTGGG + Intronic
933726602 2:85430789-85430811 GTCACCAGGGCCTCTTGGCTGGG + Intronic
934946629 2:98547205-98547227 GTGGCCAGGTGCACAGTGCTGGG + Intronic
938289544 2:130142033-130142055 CTGACCAGGTACCCTCTGCTGGG - Intronic
939083343 2:137687659-137687681 GTGGCAAGTTCCACTTTTCTAGG - Intergenic
942455815 2:176137316-176137338 CTGAACATCTCCACTTTGCTGGG + Intergenic
946490559 2:220145267-220145289 TTTAGCAGGTCCAGTTTGCTGGG + Intergenic
1168943498 20:1732666-1732688 GTGGCAAGTACCACTTTGCTGGG - Intergenic
1170056973 20:12216443-12216465 CTGCCCAGGTCCACTTTGCAGGG + Intergenic
1170705060 20:18737495-18737517 GTGTCCATGTCCCATTTGCTGGG + Intronic
1171316707 20:24201879-24201901 CTGACCAGGCCCAGTTTGATGGG - Intergenic
1172853649 20:37984488-37984510 GTGCCCAGGGCCACTGTGTTGGG + Intronic
1173570711 20:44074100-44074122 GTCATCTGGTCCACTTTGCCAGG - Intergenic
1178714489 21:34951235-34951257 GTGACAGGGGCCACTTTGGTGGG - Intronic
1180825222 22:18856823-18856845 GAGACCAGGTCCTCTGTGCATGG + Intronic
1181038998 22:20183138-20183160 GTGACAATGTCCACTTTCCCTGG + Intergenic
1181187507 22:21117724-21117746 GAGACCAGGTCCTCTGTGCATGG - Intergenic
1181211691 22:21292769-21292791 GAGACCAGGTCCTCTGTGCATGG + Intergenic
1181397818 22:22634117-22634139 GAGACCAGGTCCTCTGTGCATGG - Intergenic
1181500563 22:23313487-23313509 GAGACCAGGTCCTCTGTGCATGG - Intronic
1181651591 22:24261941-24261963 GAGACCAGGTCCTCTGTGCATGG + Intergenic
1181705784 22:24648798-24648820 GAGACCAGGTCCTCTGTGCATGG - Intergenic
1181824229 22:25501071-25501093 GTGAGCTGGTCCACTCAGCTTGG + Intergenic
1184279456 22:43428725-43428747 GTGACGAGGCCGCCTTTGCTTGG + Intronic
1203215262 22_KI270731v1_random:2663-2685 GAGACCAGGTCCTCTGTGCATGG - Intergenic
1203275368 22_KI270734v1_random:82726-82748 GAGACCAGGTCCTCTGTGCATGG + Intergenic
952289798 3:32004023-32004045 GACACCAGGTCCACAGTGCTAGG - Intronic
969542737 4:7803663-7803685 GGGACCAGGTCCCCTGTGGTTGG - Intronic
983813149 4:172089442-172089464 GTGACCAGTTTCAGTTTGCAGGG + Intronic
985576214 5:674625-674647 GTGACCAGGGCCGCTCTGGTGGG - Intronic
988730947 5:33971973-33971995 GTGCCCAGGTCCACCTGCCTTGG + Intronic
990747441 5:58974453-58974475 GTGAAGATGTCCACCTTGCTCGG + Exonic
994083563 5:95733683-95733705 GTAACCAGGTACAATTTTCTAGG + Intronic
995742462 5:115369137-115369159 GTGAGCAGCTCCTCTCTGCTAGG - Intergenic
1002442076 5:179269770-179269792 GTGTCCAGGGACACTGTGCTGGG - Intronic
1002644610 5:180646999-180647021 GGGATCAGGCCCACTTTACTTGG - Intronic
1007616272 6:43181409-43181431 GTGACCATGTCCACTATTCCTGG - Exonic
1017819812 6:158041176-158041198 GTGCCCAGGGCCACCCTGCTGGG + Intronic
1020383043 7:7566943-7566965 GTGACCTGGACCACTGGGCTGGG - Exonic
1022149504 7:27586753-27586775 GTGACCACCTCGACTTTCCTGGG + Intronic
1022364013 7:29692448-29692470 GTGACCAGGAGCACTGTTCTAGG + Intergenic
1022697354 7:32721292-32721314 GTGACCAGGAGCACTGTTCTAGG - Intergenic
1022934616 7:35159773-35159795 GTGACCAGGAGCACTGTTCTAGG - Intergenic
1029830555 7:103252553-103252575 GTGACCAGGAGCACTGTTCTAGG - Intergenic
1034608641 7:152343613-152343635 GTGACCAGGTGTAGTTTGTTTGG - Intronic
1038409619 8:27348018-27348040 CTCTCCAGGTCCACATTGCTAGG - Intronic
1038936962 8:32262889-32262911 GTGGCCAGGGCCCCTTAGCTTGG - Intronic
1046340434 8:112846959-112846981 GTGACCAGAGCTACTTTTCTTGG + Intronic
1049274034 8:141710881-141710903 GGGACCAGGACCAATTTGCCTGG - Intergenic
1055347964 9:75356641-75356663 GTGACAAGTACCACTTTTCTGGG - Intergenic
1056581656 9:87891056-87891078 GAGGCCAGGTCCCCTGTGCTGGG + Intergenic
1058423413 9:104855136-104855158 CTCACCAGGACCACTTCGCTTGG + Intronic
1062401325 9:136373925-136373947 GTGACCAGGTCAAAGTGGCTGGG - Intergenic
1186455577 X:9707645-9707667 GTGACCAGCTCTACATTCCTGGG + Intronic
1187783854 X:22862012-22862034 TTGAGCAGCTACACTTTGCTTGG + Intergenic
1188237494 X:27747839-27747861 GTGGGCAGGTCCCCTGTGCTGGG - Exonic
1188257462 X:27980465-27980487 GTGGGCAGGTCCCCTGTGCTTGG + Exonic
1189327573 X:40122183-40122205 GTGCACATGTCCACTTTGCCAGG + Intronic
1196845818 X:119896241-119896263 GTGAGCAGATCTTCTTTGCTTGG - Exonic
1198128084 X:133667527-133667549 GTCACCAAGTCAACTTTGTTAGG + Intronic
1201234422 Y:11895730-11895752 GTGACAAGTACCACTTTCCTGGG - Intergenic