ID: 1067561887

View in Genome Browser
Species Human (GRCh38)
Location 10:47310152-47310174
Sequence GATTCTGAGGAGAGGGACCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 229}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067561876_1067561887 14 Left 1067561876 10:47310115-47310137 CCGCCGGGATGGCGAGCTGCTCC 0: 1
1: 0
2: 0
3: 13
4: 102
Right 1067561887 10:47310152-47310174 GATTCTGAGGAGAGGGACCCGGG 0: 1
1: 0
2: 2
3: 20
4: 229
1067561879_1067561887 -7 Left 1067561879 10:47310136-47310158 CCTCTCCGCCCAGCTGGATTCTG 0: 1
1: 0
2: 9
3: 65
4: 699
Right 1067561887 10:47310152-47310174 GATTCTGAGGAGAGGGACCCGGG 0: 1
1: 0
2: 2
3: 20
4: 229
1067561875_1067561887 15 Left 1067561875 10:47310114-47310136 CCCGCCGGGATGGCGAGCTGCTC 0: 1
1: 0
2: 0
3: 14
4: 334
Right 1067561887 10:47310152-47310174 GATTCTGAGGAGAGGGACCCGGG 0: 1
1: 0
2: 2
3: 20
4: 229
1067561871_1067561887 30 Left 1067561871 10:47310099-47310121 CCATCGTCAAGGCGGCCCGCCGG 0: 1
1: 0
2: 0
3: 8
4: 24
Right 1067561887 10:47310152-47310174 GATTCTGAGGAGAGGGACCCGGG 0: 1
1: 0
2: 2
3: 20
4: 229
1067561877_1067561887 11 Left 1067561877 10:47310118-47310140 CCGGGATGGCGAGCTGCTCCTCT 0: 1
1: 0
2: 0
3: 14
4: 149
Right 1067561887 10:47310152-47310174 GATTCTGAGGAGAGGGACCCGGG 0: 1
1: 0
2: 2
3: 20
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067561887 Original CRISPR GATTCTGAGGAGAGGGACCC GGG Exonic
900397846 1:2460516-2460538 GAGTCTGAGGACTGGGATCCTGG + Intronic
900969059 1:5979415-5979437 GAGTTTGGGGAGAGGGAGCCAGG + Intronic
902392162 1:16113078-16113100 GACTCAGAGAAGAGGGACCTGGG - Intergenic
902599627 1:17532154-17532176 GCTGCTGAGGAGAGGGAGCAGGG - Intergenic
903776520 1:25797565-25797587 GGATTTGAGCAGAGGGACCCGGG - Intergenic
904916769 1:33976081-33976103 GATGCTGAGCCAAGGGACCCGGG + Intronic
905933139 1:41803708-41803730 GCTTCTGAGGAGAGTGTACCAGG - Intronic
906104505 1:43283891-43283913 GCTACTGAGGACAGGGGCCCTGG + Intronic
906218394 1:44058256-44058278 GATGGTGAGGAGAGAAACCCAGG - Intergenic
910407693 1:86907621-86907643 GATTCTAAGGACAGGGTTCCTGG + Intronic
912384639 1:109265172-109265194 AATCCTGCAGAGAGGGACCCAGG - Exonic
912921656 1:113874034-113874056 GATTTTGAGGAAAGGGACTATGG - Intergenic
918076487 1:181175046-181175068 GGTTCTCATCAGAGGGACCCAGG + Intergenic
919760955 1:201097731-201097753 GCTTCTTTGGAGAGTGACCCTGG - Intronic
920950739 1:210569746-210569768 GATTCTGAGGGGTGGCTCCCAGG - Intronic
922447672 1:225711286-225711308 GATTTTGGGGAGAGGGCCCAGGG + Intergenic
922476401 1:225909788-225909810 GGTGCTGAGGAGTGGCACCCTGG - Intronic
923147778 1:231209963-231209985 GTGTCTGAGGAGAGAGACCAAGG - Intronic
924275189 1:242378987-242379009 GAATGAGAGGAGAGGGAACCAGG - Intronic
924757434 1:246954107-246954129 GTTTCTGAGCACAGGGACACTGG + Intronic
1063162356 10:3428236-3428258 GCTGCTGGGGTGAGGGACCCTGG - Intergenic
1064486273 10:15794155-15794177 CATTCTGAGGAGGGTGACACAGG + Intronic
1065153095 10:22842287-22842309 GATTCTGAGCAAAGGAGCCCTGG + Intergenic
1066232183 10:33446917-33446939 GATGGTGAAGAGAAGGACCCGGG - Intergenic
1066562777 10:36688837-36688859 GGTTCTCAGGAGAAGGAGCCAGG + Intergenic
1067343466 10:45421981-45422003 GATGCTCAGGAGAGGGTCCTGGG - Intronic
1067561887 10:47310152-47310174 GATTCTGAGGAGAGGGACCCGGG + Exonic
1068072266 10:52209878-52209900 GTTGCTGAGGAGAGGGTCACAGG - Intronic
1069780035 10:70949617-70949639 GGTTTGGAGGAGAGGGACCTGGG + Intergenic
1070257368 10:74824658-74824680 GACTCTGAAGAGAGCGCCCCTGG - Intergenic
1070362837 10:75707538-75707560 GATGCTGAGCAGGGAGACCCAGG + Intronic
1071712545 10:88063795-88063817 GATTCTCAGAGGAGGGACTCTGG + Intergenic
1074007586 10:109443802-109443824 GACTCTGAGCATAAGGACCCAGG - Intergenic
1074563468 10:114554888-114554910 GACACTGAACAGAGGGACCCTGG + Intronic
1075207024 10:120457010-120457032 GCTCCTGGGGAGAGGGATCCGGG + Exonic
1075625195 10:123959094-123959116 GAGACTGAGGAGAGGGACCTTGG - Intergenic
1076739932 10:132478089-132478111 CAGGCTGAGGAGAGGGGCCCTGG + Intergenic
1077587252 11:3463163-3463185 TATTTTGAGGGGAGGAACCCTGG + Intergenic
1078635487 11:13045833-13045855 GCTTCAGAGGGGAGGGAACCTGG - Intergenic
1079999193 11:27328352-27328374 GTTTCTGCTGAGAGGCACCCTGG - Intergenic
1080702361 11:34654731-34654753 TTTTCTGAGGAGAGGGTCCAAGG + Intronic
1084829738 11:71759765-71759787 TATTTTGAGGGGAGGAACCCTGG - Intergenic
1085290697 11:75397155-75397177 GTTGCTGAGCAGAGGGACCAGGG - Intergenic
1089273271 11:117315883-117315905 GCTTCTCAGGAGAGGGAGCTTGG + Exonic
1089297744 11:117480267-117480289 GCTTCTGAAGGGAGGGACACTGG - Intronic
1089681615 11:120121889-120121911 GGTTCTGAGGAGAGGGGTGCTGG + Intronic
1090982796 11:131738156-131738178 GAATTTGAGGAGAGAAACCCAGG - Intronic
1091933861 12:4419161-4419183 GATTCTAAGAAGTGGGATCCAGG + Intergenic
1091937574 12:4445722-4445744 GGTTGAGAGCAGAGGGACCCAGG + Intergenic
1092347243 12:7725777-7725799 GATCCTTATGAGAGGGACACAGG + Intergenic
1092413497 12:8271912-8271934 GATTTTGAGGGGAGGAACCCTGG + Intergenic
1093306823 12:17530556-17530578 GATTCTGGAGAGAGGGTTCCTGG - Intergenic
1093699598 12:22203911-22203933 GGTTCTGATGAGAGTGATCCAGG + Intronic
1097743078 12:63268103-63268125 GTTTATGAGGAGGGGGACCCAGG + Intergenic
1101559739 12:105845132-105845154 GATTCTGATCAGAGGGACGTGGG - Intergenic
1101823466 12:108202164-108202186 AACTCTGAGGACAGGGACCATGG + Intronic
1101957095 12:109221579-109221601 GTTTCAGAGGAGAGGGACGTGGG - Intronic
1102121431 12:110444634-110444656 GATTCTGAGGAAAAGGAACAAGG - Intronic
1102406026 12:112674968-112674990 GATTCTGACGATAAGGTCCCTGG + Intronic
1103162263 12:118739399-118739421 GATGCTGAGCAGAGGGACAAGGG + Intergenic
1104357566 12:128101288-128101310 GACACTGAGGACAGGGACACTGG + Intergenic
1105439800 13:20405712-20405734 GATTCTAAGGAGAGGGCCCTGGG + Intronic
1106483525 13:30154356-30154378 TCTTCTGGGGAGAGGGACCTTGG - Intergenic
1106836232 13:33638195-33638217 GATCCTGAGGACATGTACCCAGG + Intergenic
1107726486 13:43304737-43304759 GTTTGAGAGGAGAGGGACACAGG - Intronic
1109239558 13:59868722-59868744 GGTTCTGAGGAGAGGGAAGAAGG - Intronic
1112194683 13:97213554-97213576 GTTTCTGAAGAAAAGGACCCAGG - Intergenic
1114327034 14:21599957-21599979 AATTCTGAGGTGAGTGATCCAGG + Intergenic
1115145418 14:30220587-30220609 GATACTTAGGAGTGTGACCCTGG - Intergenic
1119947114 14:78706493-78706515 GGTTCTGAGCATATGGACCCTGG + Intronic
1121487707 14:94331310-94331332 GATTGGCAGGAGAGGGATCCAGG - Intergenic
1122316666 14:100829379-100829401 AATTCTCAGGAGGGGGACCTGGG + Intergenic
1126049986 15:44676678-44676700 GGTCTTGAGGAGAGAGACCCTGG + Intronic
1126437254 15:48648047-48648069 GGATCTGAGCAGAGGGACCATGG + Intergenic
1128684327 15:69672361-69672383 GATCCTGAGGAGAGAGGGCCAGG + Intergenic
1129233564 15:74209869-74209891 AATTCTCAGGAGAAGGGCCCTGG + Intronic
1132875139 16:2133820-2133842 GGTTTGGAGGAGGGGGACCCTGG - Intronic
1134519848 16:14913570-14913592 GGTTTGGAGGAGGGGGACCCTGG + Intronic
1134554083 16:15152665-15152687 GGTTTGGAGGAGGGGGACCCTGG - Intergenic
1134707520 16:16312226-16312248 GGTTTGGAGGAGGGGGACCCTGG + Intergenic
1134960023 16:18399899-18399921 GGTTTGGAGGAGGGGGACCCTGG - Intergenic
1138342958 16:56302683-56302705 CCTTCTGAGAAGAGGGAGCCCGG - Intronic
1138455604 16:57119051-57119073 GAGTCTGAGGGGAGGGGGCCAGG + Intronic
1142620056 17:1159855-1159877 GATGCTGAGGAGGGAGGCCCAGG + Intronic
1143473056 17:7188160-7188182 GATCCTGGGGATAGGGACCAGGG - Intergenic
1143590189 17:7881146-7881168 GCTTCTGAGGAGAGGAACTCCGG + Intronic
1144364494 17:14529201-14529223 GATACTAAGGGGAAGGACCCTGG - Intergenic
1146987719 17:37236993-37237015 GTTTCTGAGGAGGGGTACGCAGG - Intronic
1148195412 17:45709480-45709502 GATTCTCAAGACAGTGACCCAGG - Intergenic
1149343182 17:55707652-55707674 GACTCTGAGCTGAGTGACCCTGG - Intergenic
1150968221 17:69996301-69996323 AATGCTCAGGAGAGGGACACAGG - Intergenic
1151768037 17:76142081-76142103 GATTAAGAGTAGAGGGACTCTGG + Intergenic
1151979438 17:77499838-77499860 GGCTCTGAGGGGAGGGGCCCAGG - Exonic
1153797759 18:8640468-8640490 GACTCGGAGGAGCAGGACCCTGG - Intergenic
1153980243 18:10302654-10302676 TATTCTGAGGGGAAGGAGCCAGG - Intergenic
1155045246 18:22097556-22097578 GAAACAGAGGAGAAGGACCCCGG - Intronic
1155860850 18:30897553-30897575 TATTCTGTGGAGAGGAACTCTGG - Intergenic
1157694295 18:49708603-49708625 GTTTCTGACGAGGGGGAACCAGG + Intergenic
1157809809 18:50686823-50686845 GATTCTGAGCAGTGAGACCAAGG + Intronic
1159300087 18:66552551-66552573 GACTCAGGGGAGAGGGACCTAGG + Intronic
1160702227 19:513150-513172 GATCCTGATGAGAGGGGCCCCGG + Intronic
1160965173 19:1744286-1744308 GATTCTGGGGAGATGGTACCGGG - Intergenic
1161455943 19:4369763-4369785 GGAGCTGAGCAGAGGGACCCGGG - Intronic
1163845406 19:19635643-19635665 GACTTTGAGGAGCGAGACCCTGG - Exonic
1163883474 19:19946800-19946822 GATACTGGGGAGAGGGGCCCAGG - Intergenic
1163939456 19:20478786-20478808 GATTATCAAGACAGGGACCCTGG - Intergenic
1165335696 19:35168242-35168264 GCTCCTGAGGACAGGGACCAGGG - Intronic
1165496014 19:36152235-36152257 GATTGTGGGGGAAGGGACCCAGG + Intronic
1165793520 19:38506027-38506049 GATGGAGAGGAGAGGGGCCCAGG + Intronic
1167129033 19:47572644-47572666 GATTCTGAGCAGAAGGGGCCTGG + Intergenic
925190702 2:1881099-1881121 GATTATTAAGGGAGGGACCCAGG - Intronic
925422340 2:3723227-3723249 GCTTCTGAGAGCAGGGACCCTGG - Intronic
925715431 2:6780551-6780573 CTTTCTGAGGAGTGGGACCCTGG - Intergenic
927153436 2:20208677-20208699 GATGCTGGGGAGAGCTACCCAGG - Intronic
928593465 2:32839638-32839660 AATTATGGGGAGAGAGACCCTGG - Intergenic
929082123 2:38131623-38131645 GATTCTGATGAGAAGAACCAGGG - Intergenic
931471692 2:62544954-62544976 GCTTCTGAGGACTGGGACCCAGG - Intergenic
933219967 2:79677206-79677228 GACTCTGAGAAAAGGGTCCCAGG - Intronic
933949292 2:87314253-87314275 CATTCTGAGGAGAGGTCCCCAGG + Intergenic
935028909 2:99303505-99303527 GATTCTTAGGGTGGGGACCCAGG - Intronic
936330903 2:111547344-111547366 CATTCTGAGGAGAGGTCCCCAGG - Intergenic
936674409 2:114698438-114698460 ATTTCTGAGGTGAGGCACCCTGG - Intronic
936970960 2:118175686-118175708 GTTTCTGGGGAGAGGGCCCATGG + Intergenic
937153402 2:119701444-119701466 GATTGAGAGCAGAGGGAGCCTGG + Intergenic
948591430 2:239053261-239053283 GATCCTGAACAGATGGACCCGGG - Intronic
1168765710 20:380804-380826 GATGCAGAGGAGAGAGGCCCGGG + Exonic
1169717385 20:8635498-8635520 GATTCTCAGTAGGAGGACCCAGG + Intronic
1172211235 20:33199957-33199979 GCTTGTGAGGCAAGGGACCCAGG - Intergenic
1173241183 20:41298787-41298809 GAATCTGAAGAGAGGGACTTGGG + Intronic
1176185921 20:63779001-63779023 GACTCTGAGGAGGGGCCCCCAGG - Intronic
1178352622 21:31883708-31883730 ATTTCTGAGGAGAGGGTCCATGG + Intronic
1180067482 21:45419856-45419878 GATTCTCAGGAGGGGGGTCCAGG - Intronic
1181342658 22:22195376-22195398 GATGCTGAGCAGAGGCCCCCTGG + Intergenic
1182281182 22:29218563-29218585 GTTTCTGATGAGAGGCAGCCAGG - Intronic
1184008996 22:41732595-41732617 TTTTCTGAGGTGAGAGACCCAGG + Exonic
1184080592 22:42216866-42216888 GACTCTGAGGAGACAGGCCCAGG - Intronic
1184401411 22:44276751-44276773 GATTCAGGGGAGAGAGACCAGGG + Intronic
1184889832 22:47372891-47372913 GATTCTGGGGAGAGGGATAAAGG - Intergenic
950421641 3:12903104-12903126 GAGTCTGTTGAGAGGGACCCTGG + Intronic
950510134 3:13420721-13420743 GCTTCCCAGAAGAGGGACCCCGG + Intergenic
952721650 3:36540020-36540042 GATTCTTAGAAGAGGGAGACAGG + Intronic
953382783 3:42486691-42486713 GTTTCTGAGGACAGGGGTCCAGG - Intergenic
956197462 3:66667446-66667468 GATTTAGAGGGGAGGGACCCAGG - Intergenic
957058592 3:75463098-75463120 TATTTTGAGGGGAGGAACCCTGG + Intergenic
958674316 3:97247579-97247601 CATTCTGAGTAGAAGGAACCAGG + Intronic
959477229 3:106825711-106825733 GGTTCTGAGGAAAAGGACCGAGG - Intergenic
960236712 3:115291820-115291842 CATTCTTAAAAGAGGGACCCAGG + Intergenic
961891052 3:130130562-130130584 TATTTTGAGGGGAGGAACCCTGG + Intergenic
964472663 3:157071106-157071128 GTTTCTGAGGAAAAGGACACAGG - Intergenic
967859851 3:194142176-194142198 AATTCTGATGAGAGGAAACCAGG + Intergenic
968446337 4:654157-654179 GAGTCTTAGGGGAGGGGCCCAGG + Intronic
969002440 4:3992986-3993008 TATTTTGAGGGGAGGAACCCTGG + Intergenic
969751569 4:9115532-9115554 TATTTTGAGGGGAGGAACCCTGG - Intergenic
969811486 4:9651826-9651848 TATTTTGAGGGGAGGAACCCTGG - Intergenic
970007444 4:11425272-11425294 GATTCAGACAAGGGGGACCCGGG + Intronic
970242387 4:14022912-14022934 GACACTGAGGAGAGGGAACATGG + Intergenic
975888766 4:78998599-78998621 GATTCTGAGAAGAGAAACCTGGG - Intergenic
977138560 4:93337938-93337960 ACTTCTGAGGAGAGGGACTAGGG - Intronic
977859584 4:101940710-101940732 GGTTCTGAGGAGAAAGACCATGG + Intronic
978429589 4:108619787-108619809 TTTTCTGAGAAGAGGGTCCCTGG - Intergenic
980691457 4:136300194-136300216 CATTCTGAGCATAGGGAGCCTGG + Intergenic
980954948 4:139418597-139418619 GATTAAGAGGAGTGGGAGCCTGG - Intronic
982018023 4:151174988-151175010 GATTCCGGGAAGAGGGCCCCTGG - Exonic
985262069 4:188123997-188124019 GGTGCTGAGGAGAAGCACCCTGG - Intergenic
985715978 5:1461802-1461824 TATTCCGAGGGAAGGGACCCAGG - Exonic
985718383 5:1475700-1475722 GATCATGAGCAGAGGGACCCTGG - Intronic
986729667 5:10625984-10626006 GACTCTGCAGAGAGTGACCCAGG + Intronic
988182515 5:27816056-27816078 GATTCTGAGGAATGGAACCTTGG + Intergenic
989139983 5:38192503-38192525 GATGTTGAGGAGAGGTGCCCAGG + Intergenic
990024351 5:51167235-51167257 GGTTCAGAGGAAAGGGACCACGG + Intergenic
990988570 5:61662889-61662911 GATCCTAAAGAGAAGGACCCTGG - Intronic
992111374 5:73497883-73497905 CATTCTGAGGAGTGGGGCTCGGG + Intergenic
993364591 5:87020160-87020182 GGTTCTGAGGAGAGGGAGGGAGG - Intergenic
994661261 5:102656954-102656976 GAGACTGAGGTGAGGGAACCTGG + Intergenic
997720141 5:136071495-136071517 TTTTCTGAGGAGAGGGTCCACGG - Intergenic
997836648 5:137199806-137199828 GAATGTCAGGGGAGGGACCCAGG - Intronic
1001335231 5:170791174-170791196 CATTCTGAGAACAGGGAGCCTGG + Intronic
1002709215 5:181184163-181184185 GATCCCGGGGCGAGGGACCCTGG + Intergenic
1003316335 6:5015527-5015549 GATTCCCTGGAGTGGGACCCAGG + Intergenic
1004680853 6:17892925-17892947 GAACCTGAGGAGGGGGACACGGG + Intronic
1004921400 6:20379437-20379459 GGATCTGGGGAGAGGCACCCAGG - Intergenic
1005825502 6:29629229-29629251 GTTTCTGAGGGGAGGGTGCCTGG + Intronic
1006410506 6:33870830-33870852 GAAGGTGAGGAGAGGGTCCCAGG + Intergenic
1007292776 6:40799753-40799775 GAGTCTGAGGAGATGCACCTAGG + Intergenic
1008441592 6:51538181-51538203 GATGCTTAGGAGAGGGACCCTGG + Intergenic
1011313849 6:86009801-86009823 GATTCTGAGTAGAGGGAAAAAGG + Intergenic
1014492352 6:122078106-122078128 GAATCTGAGGAGAGGGTCATGGG + Intergenic
1015320351 6:131866162-131866184 GATTCTGACAGGAGGGATCCTGG - Intronic
1015868704 6:137754013-137754035 AATTCAGAAGAGAGGGACCATGG - Intergenic
1017065038 6:150520623-150520645 GATTGGGAGGAGAGGGTGCCAGG - Intergenic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1018163988 6:161076554-161076576 ACTTCTGAGGCCAGGGACCCAGG - Intronic
1018429092 6:163709559-163709581 GATACTGAGGAGAGAGGCCGGGG + Intergenic
1020321439 7:6941439-6941461 TATTTTGAGGGGAGGAACCCTGG + Intergenic
1021625310 7:22587176-22587198 GATTGGGAGGAGAGGGGCCCAGG - Intronic
1021839999 7:24714583-24714605 GCTGCTGAGAAGAGGTACCCTGG - Intronic
1021855532 7:24851097-24851119 GATCATGGGGAGAGGGACCTTGG + Intronic
1022836601 7:34122474-34122496 GATTTTGAATAGAGGGACCAGGG + Intronic
1023661955 7:42479108-42479130 GATTCTGAGAATAGACACCCAGG - Intergenic
1024966775 7:55030055-55030077 GATTGGGAGGTGAGGGACCCAGG + Intronic
1025059715 7:55795417-55795439 GAATCTGAAAAGAGGGACACAGG + Exonic
1026335253 7:69388880-69388902 TATTCAGAGGAGATGGACTCAGG - Intergenic
1026466840 7:70661753-70661775 GAGTCTGGGGAGGTGGACCCAGG + Intronic
1028210846 7:88072719-88072741 GATTCCCAGGAGAGGGAACCTGG + Intronic
1029239538 7:99149605-99149627 GATTTTGTGCAGAGGGTCCCTGG + Intergenic
1029818932 7:103126574-103126596 CATTCTGAGGAGGTGGCCCCTGG - Intronic
1030241703 7:107333220-107333242 GATTCAAAGCAGAGGGATCCTGG + Intronic
1031091376 7:117359424-117359446 AATTCAGAGGAGAGAGACACAGG - Intergenic
1031972836 7:128076423-128076445 GATTTGCAGGAGAGGGACCCAGG - Intronic
1032154522 7:129456951-129456973 AATCCTGGGGATAGGGACCCAGG + Intronic
1032713602 7:134484921-134484943 GATTTTGAGGAGAGGGTTCAAGG - Intergenic
1034978892 7:155463364-155463386 GAGGGTGAGGAGAGGGAGCCGGG - Exonic
1035263654 7:157676746-157676768 GACCCTGTGGAAAGGGACCCAGG - Intronic
1036406017 8:8455837-8455859 GGATCTGAGGACAGGCACCCAGG - Intergenic
1036989684 8:13578606-13578628 GAACCTGAGGAGAGGGTCCTGGG - Intergenic
1040923437 8:52650308-52650330 GATGCTGAAGAGAGAGACTCTGG + Intronic
1042230429 8:66548882-66548904 GATAGTGATGAGAGGAACCCTGG - Intergenic
1042766445 8:72327201-72327223 GATTAGAAGGAGAGGGACACTGG - Intergenic
1042878064 8:73457914-73457936 GGGTCTCAGGAGAGGGACCTAGG + Intronic
1044094922 8:88051530-88051552 GATTCTGAGGAATGGGACTTTGG - Intronic
1044373300 8:91440213-91440235 GAATCTTGGAAGAGGGACCCTGG + Intergenic
1045102801 8:98862214-98862236 GATTCTGAGAAGAGAAACTCTGG + Intronic
1046858967 8:119068787-119068809 GATCCTGGGGAGAGGGACTTGGG + Intronic
1049593130 8:143471598-143471620 GATTCTGTGGGGAGGGACCCTGG + Intronic
1052990836 9:34518649-34518671 TTTTCTGAGGAGAGAGACCCAGG + Intronic
1054172782 9:61856359-61856381 GATCCTGAGGACAGGACCCCTGG + Intergenic
1054664758 9:67724442-67724464 GATCCTGAGGACAGGACCCCTGG - Intergenic
1057039867 9:91840179-91840201 GAATCAGAGCGGAGGGACCCGGG + Intronic
1057220653 9:93256172-93256194 GTTCCTGGGAAGAGGGACCCTGG + Intronic
1057302822 9:93896439-93896461 GATTCCTGGCAGAGGGACCCCGG - Intergenic
1059422978 9:114204505-114204527 GATACTGATGAGAAGGACTCTGG - Intronic
1060032452 9:120227128-120227150 GATTCTGAGTGGAAGCACCCTGG - Intergenic
1060834355 9:126743881-126743903 GATTCTCAGGGGAGGGCCACAGG - Intergenic
1060945613 9:127568285-127568307 GATTCTGGGGAGTGGGGCCAGGG - Intronic
1061189153 9:129071613-129071635 CATTCAGGGGAGAGGGGCCCTGG - Exonic
1061202625 9:129146390-129146412 ATTTTTGAGGAGAGGGAACCTGG + Intronic
1062252573 9:135605677-135605699 GGCTCTGAGCAGAGGGAGCCAGG - Intergenic
1062534460 9:137015348-137015370 GATTCTCAGGTGGGGGTCCCGGG + Intronic
1185542643 X:915804-915826 GTTTCTGAGAAGAGGGAAGCAGG - Intergenic
1186131397 X:6469771-6469793 GATTCTGAGGATTAGGACCGTGG - Intergenic
1186414384 X:9370525-9370547 GATGCTGGGGAGAGGAACCGAGG + Intergenic
1191242944 X:58203621-58203643 CATTCTAACGAGAGGGACTCAGG + Intergenic
1191849018 X:65571896-65571918 GATTCTGAGCAGAGGGAGGAAGG + Intergenic
1191953832 X:66623077-66623099 GAATCTTAGGGGAGGGACCCAGG - Intronic
1193234727 X:79092935-79092957 GATTCTGAGAAGAGGGGGCAGGG - Intergenic
1194243106 X:91475877-91475899 GATGTTGGGGAGAGGGAGCCAGG + Intergenic
1195111612 X:101656558-101656580 GATTCTGAGGAAGGGGAGTCCGG - Exonic
1195688945 X:107608416-107608438 GATGCTGCGGAGAATGACCCTGG - Intergenic
1197853746 X:130892509-130892531 GAATCTGAGAAGAGGGCCACAGG - Intronic
1199955141 X:152736086-152736108 GGTTCTGAGGAGACAGGCCCCGG + Exonic
1200161696 X:154013005-154013027 GGTTCCCAGGAGAGGGACCAAGG - Intronic
1201970553 Y:19789250-19789272 GATTTTCAGGAGAGGAATCCAGG + Intergenic