ID: 1067562733

View in Genome Browser
Species Human (GRCh38)
Location 10:47315200-47315222
Sequence GAGGCATTCCAGGTATTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067562733_1067562741 3 Left 1067562733 10:47315200-47315222 CCCCCAAATACCTGGAATGCCTC No data
Right 1067562741 10:47315226-47315248 GTCCTCATGTCTGGCTTACTGGG No data
1067562733_1067562740 2 Left 1067562733 10:47315200-47315222 CCCCCAAATACCTGGAATGCCTC No data
Right 1067562740 10:47315225-47315247 AGTCCTCATGTCTGGCTTACTGG No data
1067562733_1067562748 18 Left 1067562733 10:47315200-47315222 CCCCCAAATACCTGGAATGCCTC No data
Right 1067562748 10:47315241-47315263 TTACTGGGATTGGGGAGGGCAGG No data
1067562733_1067562746 13 Left 1067562733 10:47315200-47315222 CCCCCAAATACCTGGAATGCCTC No data
Right 1067562746 10:47315236-47315258 CTGGCTTACTGGGATTGGGGAGG No data
1067562733_1067562747 14 Left 1067562733 10:47315200-47315222 CCCCCAAATACCTGGAATGCCTC No data
Right 1067562747 10:47315237-47315259 TGGCTTACTGGGATTGGGGAGGG No data
1067562733_1067562749 22 Left 1067562733 10:47315200-47315222 CCCCCAAATACCTGGAATGCCTC No data
Right 1067562749 10:47315245-47315267 TGGGATTGGGGAGGGCAGGCTGG No data
1067562733_1067562743 8 Left 1067562733 10:47315200-47315222 CCCCCAAATACCTGGAATGCCTC No data
Right 1067562743 10:47315231-47315253 CATGTCTGGCTTACTGGGATTGG No data
1067562733_1067562738 -6 Left 1067562733 10:47315200-47315222 CCCCCAAATACCTGGAATGCCTC No data
Right 1067562738 10:47315217-47315239 TGCCTCTGAGTCCTCATGTCTGG No data
1067562733_1067562744 9 Left 1067562733 10:47315200-47315222 CCCCCAAATACCTGGAATGCCTC No data
Right 1067562744 10:47315232-47315254 ATGTCTGGCTTACTGGGATTGGG No data
1067562733_1067562750 23 Left 1067562733 10:47315200-47315222 CCCCCAAATACCTGGAATGCCTC No data
Right 1067562750 10:47315246-47315268 GGGATTGGGGAGGGCAGGCTGGG No data
1067562733_1067562745 10 Left 1067562733 10:47315200-47315222 CCCCCAAATACCTGGAATGCCTC No data
Right 1067562745 10:47315233-47315255 TGTCTGGCTTACTGGGATTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067562733 Original CRISPR GAGGCATTCCAGGTATTTGG GGG (reversed) Intergenic
No off target data available for this crispr