ID: 1067564579

View in Genome Browser
Species Human (GRCh38)
Location 10:47327294-47327316
Sequence TCAACCACGGGGAGAGGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067564579_1067564593 13 Left 1067564579 10:47327294-47327316 CCAGGGCCTCTCCCCGTGGTTGA No data
Right 1067564593 10:47327330-47327352 TTAAGAAAAAGTGGGGGGTGGGG No data
1067564579_1067564589 7 Left 1067564579 10:47327294-47327316 CCAGGGCCTCTCCCCGTGGTTGA No data
Right 1067564589 10:47327324-47327346 ATTTATTTAAGAAAAAGTGGGGG No data
1067564579_1067564585 4 Left 1067564579 10:47327294-47327316 CCAGGGCCTCTCCCCGTGGTTGA No data
Right 1067564585 10:47327321-47327343 CCCATTTATTTAAGAAAAAGTGG No data
1067564579_1067564590 8 Left 1067564579 10:47327294-47327316 CCAGGGCCTCTCCCCGTGGTTGA No data
Right 1067564590 10:47327325-47327347 TTTATTTAAGAAAAAGTGGGGGG No data
1067564579_1067564587 5 Left 1067564579 10:47327294-47327316 CCAGGGCCTCTCCCCGTGGTTGA No data
Right 1067564587 10:47327322-47327344 CCATTTATTTAAGAAAAAGTGGG No data
1067564579_1067564588 6 Left 1067564579 10:47327294-47327316 CCAGGGCCTCTCCCCGTGGTTGA No data
Right 1067564588 10:47327323-47327345 CATTTATTTAAGAAAAAGTGGGG No data
1067564579_1067564591 11 Left 1067564579 10:47327294-47327316 CCAGGGCCTCTCCCCGTGGTTGA No data
Right 1067564591 10:47327328-47327350 ATTTAAGAAAAAGTGGGGGGTGG No data
1067564579_1067564592 12 Left 1067564579 10:47327294-47327316 CCAGGGCCTCTCCCCGTGGTTGA No data
Right 1067564592 10:47327329-47327351 TTTAAGAAAAAGTGGGGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067564579 Original CRISPR TCAACCACGGGGAGAGGCCC TGG (reversed) Intergenic
No off target data available for this crispr