ID: 1067566807

View in Genome Browser
Species Human (GRCh38)
Location 10:47345575-47345597
Sequence GGCTGCTGCAGGGATGGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067566807_1067566821 26 Left 1067566807 10:47345575-47345597 CCCTGACCATCCCTGCAGCAGCC No data
Right 1067566821 10:47345624-47345646 CCTGCGCTGCAGGTGCTGCAGGG No data
1067566807_1067566822 30 Left 1067566807 10:47345575-47345597 CCCTGACCATCCCTGCAGCAGCC No data
Right 1067566822 10:47345628-47345650 CGCTGCAGGTGCTGCAGGGCTGG No data
1067566807_1067566819 25 Left 1067566807 10:47345575-47345597 CCCTGACCATCCCTGCAGCAGCC No data
Right 1067566819 10:47345623-47345645 ACCTGCGCTGCAGGTGCTGCAGG No data
1067566807_1067566816 16 Left 1067566807 10:47345575-47345597 CCCTGACCATCCCTGCAGCAGCC No data
Right 1067566816 10:47345614-47345636 CCCCTCTTAACCTGCGCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067566807 Original CRISPR GGCTGCTGCAGGGATGGTCA GGG (reversed) Intergenic
No off target data available for this crispr