ID: 1067566810

View in Genome Browser
Species Human (GRCh38)
Location 10:47345585-47345607
Sequence GACACATCAGGGCTGCTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067566810_1067566821 16 Left 1067566810 10:47345585-47345607 CCCTGCAGCAGCCCTGATGTGTC No data
Right 1067566821 10:47345624-47345646 CCTGCGCTGCAGGTGCTGCAGGG No data
1067566810_1067566822 20 Left 1067566810 10:47345585-47345607 CCCTGCAGCAGCCCTGATGTGTC No data
Right 1067566822 10:47345628-47345650 CGCTGCAGGTGCTGCAGGGCTGG No data
1067566810_1067566819 15 Left 1067566810 10:47345585-47345607 CCCTGCAGCAGCCCTGATGTGTC No data
Right 1067566819 10:47345623-47345645 ACCTGCGCTGCAGGTGCTGCAGG No data
1067566810_1067566823 21 Left 1067566810 10:47345585-47345607 CCCTGCAGCAGCCCTGATGTGTC No data
Right 1067566823 10:47345629-47345651 GCTGCAGGTGCTGCAGGGCTGGG No data
1067566810_1067566824 27 Left 1067566810 10:47345585-47345607 CCCTGCAGCAGCCCTGATGTGTC No data
Right 1067566824 10:47345635-47345657 GGTGCTGCAGGGCTGGGCTCTGG No data
1067566810_1067566816 6 Left 1067566810 10:47345585-47345607 CCCTGCAGCAGCCCTGATGTGTC No data
Right 1067566816 10:47345614-47345636 CCCCTCTTAACCTGCGCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067566810 Original CRISPR GACACATCAGGGCTGCTGCA GGG (reversed) Intergenic
No off target data available for this crispr