ID: 1067566811

View in Genome Browser
Species Human (GRCh38)
Location 10:47345586-47345608
Sequence TGACACATCAGGGCTGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067566811_1067566816 5 Left 1067566811 10:47345586-47345608 CCTGCAGCAGCCCTGATGTGTCA No data
Right 1067566816 10:47345614-47345636 CCCCTCTTAACCTGCGCTGCAGG No data
1067566811_1067566821 15 Left 1067566811 10:47345586-47345608 CCTGCAGCAGCCCTGATGTGTCA No data
Right 1067566821 10:47345624-47345646 CCTGCGCTGCAGGTGCTGCAGGG No data
1067566811_1067566819 14 Left 1067566811 10:47345586-47345608 CCTGCAGCAGCCCTGATGTGTCA No data
Right 1067566819 10:47345623-47345645 ACCTGCGCTGCAGGTGCTGCAGG No data
1067566811_1067566824 26 Left 1067566811 10:47345586-47345608 CCTGCAGCAGCCCTGATGTGTCA No data
Right 1067566824 10:47345635-47345657 GGTGCTGCAGGGCTGGGCTCTGG No data
1067566811_1067566823 20 Left 1067566811 10:47345586-47345608 CCTGCAGCAGCCCTGATGTGTCA No data
Right 1067566823 10:47345629-47345651 GCTGCAGGTGCTGCAGGGCTGGG No data
1067566811_1067566822 19 Left 1067566811 10:47345586-47345608 CCTGCAGCAGCCCTGATGTGTCA No data
Right 1067566822 10:47345628-47345650 CGCTGCAGGTGCTGCAGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067566811 Original CRISPR TGACACATCAGGGCTGCTGC AGG (reversed) Intergenic
No off target data available for this crispr