ID: 1067566812

View in Genome Browser
Species Human (GRCh38)
Location 10:47345596-47345618
Sequence AGGGGGACAATGACACATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067566812_1067566816 -5 Left 1067566812 10:47345596-47345618 CCCTGATGTGTCATTGTCCCCCT No data
Right 1067566816 10:47345614-47345636 CCCCTCTTAACCTGCGCTGCAGG No data
1067566812_1067566822 9 Left 1067566812 10:47345596-47345618 CCCTGATGTGTCATTGTCCCCCT No data
Right 1067566822 10:47345628-47345650 CGCTGCAGGTGCTGCAGGGCTGG No data
1067566812_1067566824 16 Left 1067566812 10:47345596-47345618 CCCTGATGTGTCATTGTCCCCCT No data
Right 1067566824 10:47345635-47345657 GGTGCTGCAGGGCTGGGCTCTGG No data
1067566812_1067566827 29 Left 1067566812 10:47345596-47345618 CCCTGATGTGTCATTGTCCCCCT No data
Right 1067566827 10:47345648-47345670 TGGGCTCTGGAGCCTGGGTCTGG No data
1067566812_1067566825 23 Left 1067566812 10:47345596-47345618 CCCTGATGTGTCATTGTCCCCCT No data
Right 1067566825 10:47345642-47345664 CAGGGCTGGGCTCTGGAGCCTGG No data
1067566812_1067566823 10 Left 1067566812 10:47345596-47345618 CCCTGATGTGTCATTGTCCCCCT No data
Right 1067566823 10:47345629-47345651 GCTGCAGGTGCTGCAGGGCTGGG No data
1067566812_1067566826 24 Left 1067566812 10:47345596-47345618 CCCTGATGTGTCATTGTCCCCCT No data
Right 1067566826 10:47345643-47345665 AGGGCTGGGCTCTGGAGCCTGGG No data
1067566812_1067566819 4 Left 1067566812 10:47345596-47345618 CCCTGATGTGTCATTGTCCCCCT No data
Right 1067566819 10:47345623-47345645 ACCTGCGCTGCAGGTGCTGCAGG No data
1067566812_1067566821 5 Left 1067566812 10:47345596-47345618 CCCTGATGTGTCATTGTCCCCCT No data
Right 1067566821 10:47345624-47345646 CCTGCGCTGCAGGTGCTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067566812 Original CRISPR AGGGGGACAATGACACATCA GGG (reversed) Intergenic
No off target data available for this crispr