ID: 1067566821

View in Genome Browser
Species Human (GRCh38)
Location 10:47345624-47345646
Sequence CCTGCGCTGCAGGTGCTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067566813_1067566821 4 Left 1067566813 10:47345597-47345619 CCTGATGTGTCATTGTCCCCCTC No data
Right 1067566821 10:47345624-47345646 CCTGCGCTGCAGGTGCTGCAGGG No data
1067566809_1067566821 20 Left 1067566809 10:47345581-47345603 CCATCCCTGCAGCAGCCCTGATG No data
Right 1067566821 10:47345624-47345646 CCTGCGCTGCAGGTGCTGCAGGG No data
1067566807_1067566821 26 Left 1067566807 10:47345575-47345597 CCCTGACCATCCCTGCAGCAGCC No data
Right 1067566821 10:47345624-47345646 CCTGCGCTGCAGGTGCTGCAGGG No data
1067566808_1067566821 25 Left 1067566808 10:47345576-47345598 CCTGACCATCCCTGCAGCAGCCC No data
Right 1067566821 10:47345624-47345646 CCTGCGCTGCAGGTGCTGCAGGG No data
1067566812_1067566821 5 Left 1067566812 10:47345596-47345618 CCCTGATGTGTCATTGTCCCCCT No data
Right 1067566821 10:47345624-47345646 CCTGCGCTGCAGGTGCTGCAGGG No data
1067566811_1067566821 15 Left 1067566811 10:47345586-47345608 CCTGCAGCAGCCCTGATGTGTCA No data
Right 1067566821 10:47345624-47345646 CCTGCGCTGCAGGTGCTGCAGGG No data
1067566810_1067566821 16 Left 1067566810 10:47345585-47345607 CCCTGCAGCAGCCCTGATGTGTC No data
Right 1067566821 10:47345624-47345646 CCTGCGCTGCAGGTGCTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067566821 Original CRISPR CCTGCGCTGCAGGTGCTGCA GGG Intergenic
No off target data available for this crispr