ID: 1067567282

View in Genome Browser
Species Human (GRCh38)
Location 10:47348547-47348569
Sequence GCACCAGGCTTGGCTGGAAC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 257}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067567282_1067567289 1 Left 1067567282 10:47348547-47348569 CCTGTTCCAGCCAAGCCTGGTGC 0: 1
1: 0
2: 0
3: 18
4: 257
Right 1067567289 10:47348571-47348593 GGACATGGCCAAGGTCCTCTTGG 0: 1
1: 0
2: 2
3: 17
4: 192
1067567282_1067567292 19 Left 1067567282 10:47348547-47348569 CCTGTTCCAGCCAAGCCTGGTGC 0: 1
1: 0
2: 0
3: 18
4: 257
Right 1067567292 10:47348589-47348611 CTTGGATAACTACTGCTTCCCGG 0: 1
1: 0
2: 0
3: 14
4: 136
1067567282_1067567288 -8 Left 1067567282 10:47348547-47348569 CCTGTTCCAGCCAAGCCTGGTGC 0: 1
1: 0
2: 0
3: 18
4: 257
Right 1067567288 10:47348562-47348584 CCTGGTGCTGGACATGGCCAAGG 0: 1
1: 0
2: 3
3: 29
4: 366

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067567282 Original CRISPR GCACCAGGCTTGGCTGGAAC AGG (reversed) Exonic
900240935 1:1616896-1616918 GCAACAGGCCAGGGTGGAACCGG - Intronic
901377477 1:8849491-8849513 ACACCAGGCTAGGCTAGGACTGG - Intergenic
902405973 1:16183822-16183844 GCTCCAGGCTTGGGCGGAGCTGG - Intergenic
902567013 1:17318249-17318271 GCACCAGGCTGGGCTGCAAGAGG + Intronic
902955557 1:19922439-19922461 GAGCCAGGCTGGGCTGGACCAGG + Intronic
903203123 1:21759619-21759641 GCACAAGAGTTGGCTGGAAGGGG + Intronic
903252893 1:22069461-22069483 CCACCACGCTTGGCCGAAACAGG + Intronic
903296309 1:22345298-22345320 GCACCAGTGTTGGATGGAGCTGG - Intergenic
903296336 1:22345418-22345440 GCACCAGGGGTGGATGGAGCTGG - Intergenic
903606148 1:24576459-24576481 GGCCCAGGCTTGGCAGGAAAGGG + Intronic
904416782 1:30366921-30366943 GCTTCAGGCATGGCTGGATCCGG + Intergenic
904555570 1:31360972-31360994 GGACCAGGCTTGCAGGGAACTGG + Intronic
904893612 1:33797801-33797823 GCCCCAGGGCTGGCTGGAAGGGG - Intronic
906292449 1:44628062-44628084 GAACCAGGGTTGTCTGGATCGGG - Intronic
906482609 1:46209371-46209393 GCACCAGGTATTTCTGGAACTGG + Intronic
907303169 1:53500713-53500735 GCCCCAGGCCTGGGTGCAACAGG - Intergenic
907522291 1:55032037-55032059 GCTCCAGGCATGGCTGAAAGGGG + Intergenic
907584912 1:55608481-55608503 GCTCCAGGCTTGGCTAAAAGAGG - Intergenic
907606956 1:55827724-55827746 GCACCAGTCATGGCTAGAAAAGG + Intergenic
908715723 1:67067659-67067681 GCACCAGCCTTGGCTAAAAGAGG + Intergenic
912637567 1:111312230-111312252 GCCCCAGGCCTGGCCGGTACTGG - Exonic
915335022 1:155136070-155136092 GCACCTGGCTCGTCCGGAACCGG + Intronic
916628530 1:166586560-166586582 GCAACAGGCTGGGCTGGATTTGG - Intergenic
917525939 1:175788627-175788649 GTACCAGGCTGGGCTGGCATGGG + Intergenic
917719624 1:177774807-177774829 TCACCAGGCATGGCAGGATCAGG + Intergenic
922665733 1:227466883-227466905 GCACCAAACTGGGCTGGATCAGG + Intergenic
922959594 1:229635213-229635235 GGACCAGGCACGGCTGGAGCAGG - Exonic
923555775 1:234999429-234999451 GTACCAGGCTTGTCTGGAAATGG - Intergenic
924678502 1:246205532-246205554 CCACCACGCTGGGCCGGAACTGG - Intronic
1063124857 10:3128896-3128918 GGACCTGGGGTGGCTGGAACAGG + Intronic
1063477759 10:6343782-6343804 GAACCAGGCTGGGCAGGAATAGG - Intergenic
1063580467 10:7301771-7301793 GCACCAGGAAAGGCTGGAATGGG - Intronic
1065282169 10:24150694-24150716 GCATCAGGCATGGCTGCATCTGG + Intronic
1067430408 10:46239879-46239901 GCAGCAAGCTTGGCTGGGATTGG + Intergenic
1067567282 10:47348547-47348569 GCACCAGGCTTGGCTGGAACAGG - Exonic
1069651558 10:70053312-70053334 GCCCCAGGCGAGGCTGGACCCGG + Intronic
1072052882 10:91724041-91724063 GCACCAGGCTTGGATGGGGCAGG - Intergenic
1072499821 10:96002890-96002912 CCACCACACTTGGCTGGACCCGG - Intronic
1074188146 10:111114547-111114569 GCTCCAGGCCTAGCTGGAACAGG - Intergenic
1075223824 10:120607392-120607414 GCCATAGGCTTGGCTGGAATTGG - Intergenic
1075675775 10:124294896-124294918 CCACCCTGCTTGGCTGGCACAGG + Intergenic
1075985868 10:126784619-126784641 GTTCCAGGCTTGGCTGGGAGAGG - Intergenic
1076653118 10:132003689-132003711 GCCCCAAGCTTGGCTGGGAATGG + Intergenic
1077327125 11:1968748-1968770 ACACCAGGCATGGCTGGGAGGGG - Intronic
1080210783 11:29782411-29782433 CTACCAGGGTTGGCTGAAACAGG - Intergenic
1080687098 11:34524792-34524814 CCACCAGGCTGGGCTGGACTCGG + Intergenic
1080991814 11:37545766-37545788 GCTCCAGGCATGGCTGAAAGGGG - Intergenic
1083301956 11:61744246-61744268 GCACCAGGTTGGGCTCGAACTGG - Exonic
1083419427 11:62544920-62544942 GCACTAGGCTGTGCTGGGACGGG + Intronic
1084085285 11:66852276-66852298 GCACCAGGCCTGGCCGGAGAGGG + Intronic
1084733501 11:71089653-71089675 GCACCCGGAATGGCTGGAAGTGG + Intronic
1085186454 11:74579943-74579965 GCACCCTGCTTGGCTAAAACTGG - Intronic
1085405177 11:76257360-76257382 GCCCCAGGCTAGGCTGGGAGAGG - Intergenic
1089337679 11:117736217-117736239 CCACGAGGCTTGGCTGGTGCTGG + Intronic
1090672670 11:128960047-128960069 GCAGCAGGCTTGCCTTGAGCAGG + Intergenic
1090822536 11:130356728-130356750 GCCCCAGGCTGGTCTTGAACTGG - Intergenic
1091338632 11:134793499-134793521 GCCTCAGACTAGGCTGGAACAGG - Intergenic
1202810107 11_KI270721v1_random:23928-23950 ACACCAGGCATGGCTGGGAGGGG - Intergenic
1091726869 12:2852572-2852594 GCCCCAGGCTGGTCTTGAACTGG + Intronic
1096509563 12:52120156-52120178 GCACCACGCCCGCCTGGAACAGG - Intergenic
1097216958 12:57421714-57421736 GCCCCAGGCTAGTCTCGAACTGG + Intronic
1101724771 12:107379704-107379726 GCACTAGGCTTTGCTGGTAGTGG - Intronic
1103533645 12:121619988-121620010 GCACCAGGGCTGGCTGGCAGAGG + Intergenic
1104068942 12:125328258-125328280 GCACCGTGCTGGGCTGGAAAGGG - Intronic
1105411479 13:20174929-20174951 GCCCCAGGCTTGGCTGTGATGGG + Intergenic
1108419456 13:50233807-50233829 GCTCCAGCCTTGGCTGAAAAAGG + Intronic
1110278203 13:73662249-73662271 GCCCCCAGCTTGGCTGGGACAGG - Intergenic
1113326992 13:109292067-109292089 GAACGAGGCTTGGGTGCAACGGG - Intergenic
1113404257 13:110023350-110023372 GCACCAGTCATGGCAGGGACAGG - Intergenic
1114649861 14:24277719-24277741 CCACCATGCTTTGCTGGAGCCGG + Intergenic
1117181937 14:53200366-53200388 GCCCCAGCCATGGCTGGAAGGGG + Intergenic
1118460063 14:65979486-65979508 GCTCCAGCCTTGGCTGAAAGGGG + Intronic
1121591305 14:95113737-95113759 GCACCAGGGAAGGTTGGAACAGG + Intronic
1121896060 14:97648945-97648967 GCACCAGGCTTGGCCTGTGCTGG + Intergenic
1122539957 14:102492611-102492633 GCATCGGGCTGGGCTGGAGCTGG + Intronic
1125727841 15:41877127-41877149 CCACCAGGCCTGGCTGCACCTGG - Exonic
1126527837 15:49677440-49677462 CCACCATGCCTGGCTTGAACTGG + Intergenic
1126741546 15:51781565-51781587 GTACCAGGCTTGCCTGGGGCAGG + Intronic
1127576278 15:60295374-60295396 GCTCCAGCCTTGGCTGAAAGGGG - Intergenic
1127999329 15:64176204-64176226 GGACCAGACTAGGCTGGGACTGG - Intronic
1128344782 15:66846671-66846693 CCACCACGCCTGGCTGGAAGTGG + Intergenic
1130409701 15:83634979-83635001 CCACCAGGATTGCCTGCAACAGG + Intergenic
1130626482 15:85520916-85520938 GCAACAGGCTTGCCTGGAAAGGG - Intronic
1132122783 15:99192437-99192459 GCTCCAGCCTTGGCTGAAAGGGG + Intronic
1132583713 16:696746-696768 GCACCAGGCTCGGGGGGGACAGG - Intronic
1132819568 16:1856969-1856991 GCCCCAGGCTGGTCTTGAACTGG + Intronic
1132997867 16:2832642-2832664 TCACCAGGCTCGCCTGGCACTGG + Intronic
1133050762 16:3116007-3116029 GCTTCAGGCTTGGCTGCAAGTGG - Intronic
1133839721 16:9396502-9396524 TCACCAGGTTTGGGTGGAACAGG - Intergenic
1134152154 16:11813469-11813491 GCACCACGCCTGGCTGGATGTGG - Intergenic
1134253098 16:12588540-12588562 CCACCATGCCTGGCTGGATCTGG - Intergenic
1135667878 16:24351281-24351303 CCACCATGCCTGGCTGAAACTGG - Intronic
1136155792 16:28381110-28381132 CCACCACGCCTGGCTGGAAGAGG - Intronic
1136207292 16:28734179-28734201 CCACCACGCCTGGCTGGAAGAGG + Intronic
1137446326 16:48534756-48534778 GCACGAGGCATAGCTGGAAGAGG - Intergenic
1138658344 16:58503331-58503353 GGGCTAGGCTTGGCTGGCACGGG + Intronic
1138738403 16:59279574-59279596 GCAGCTGGCTCGGATGGAACTGG + Intergenic
1139362078 16:66406287-66406309 GACCCAGGGTTGGCTGGAGCAGG - Intergenic
1139749584 16:69101259-69101281 ACAGCAGGCCCGGCTGGAACAGG + Intergenic
1140803590 16:78511490-78511512 GCAACAGGCTTGGGGGCAACAGG - Intronic
1141520787 16:84577530-84577552 CCACCATGCCTGGCCGGAACAGG + Intronic
1141711383 16:85701208-85701230 GCACCAGGCTTCCATGAAACTGG + Intronic
1143187705 17:5020541-5020563 GGAGCAGGCAAGGCTGGAACGGG + Exonic
1144485931 17:15664323-15664345 GCACCAGGTTTGGCCACAACTGG + Intronic
1145759339 17:27417265-27417287 GCTCCAGGTTTGGATGGCACAGG + Intergenic
1146697350 17:34919862-34919884 GCTCCAGACTTGGCTGAAAGGGG + Intergenic
1147961581 17:44170843-44170865 GCAGCAGGAGTGGCTGGAATGGG + Exonic
1148733584 17:49851996-49852018 GATCCAGGCTGGGCTGGAGCTGG + Intergenic
1149141409 17:53436977-53436999 GCACTGGGCTGGGCAGGAACTGG - Intergenic
1149899194 17:60458144-60458166 CCACCATGCCTGGCTGGAAAAGG - Intronic
1151659997 17:75514081-75514103 GCTCCAGGATGGGCTGGGACTGG + Exonic
1151894299 17:76969672-76969694 GCACCAGGAAGGGCTGGAACGGG - Intergenic
1152503423 17:80729174-80729196 TCCCCAGGCTTTGCTGGATCTGG + Intronic
1153623375 18:7000740-7000762 GAACCAGACTTGGCTCTAACTGG - Intronic
1156485514 18:37463285-37463307 GCACCAGGCCTGGCTGCAGCAGG + Intronic
1157413009 18:47479609-47479631 GCACCATGCTTGGCAGGCAGAGG + Intergenic
1157664018 18:49470075-49470097 GCCCCTGGCTTGGTTGGACCAGG + Intergenic
1158495176 18:57948938-57948960 GCACAAGGCTTGGCTGGGCAAGG - Intergenic
1160268913 18:77366320-77366342 GCTCCAGGCTTGGCAGGATAGGG - Intergenic
1161389275 19:4012789-4012811 GCGCCAGCCTTGGCTGGGGCTGG - Intronic
1161762754 19:6186624-6186646 GCTTCAGGCATGGCTGGATCTGG + Intronic
1162244122 19:9384562-9384584 CCACCATGCCTGGCCGGAACTGG + Intergenic
1162373985 19:10294435-10294457 TCACCAGACGTGGCTGGAAGGGG + Exonic
1162901612 19:13798481-13798503 CCACCAGGCTTTGGTGGAGCAGG - Intronic
1164274601 19:23705457-23705479 GCTCCAGCCATGGCTGAAACGGG + Intergenic
1164643250 19:29841657-29841679 GCCTCAGGCATGGCTGGATCAGG + Intergenic
1165096348 19:33411865-33411887 GGCCCAGGCGTGGCTGGACCAGG + Intronic
1166971696 19:46573020-46573042 GCTCCAGGCTTGGCTAGACAAGG - Intronic
1167535752 19:50050495-50050517 GCACAAGGATTGGCTGGAGTAGG - Intronic
1167932023 19:52873741-52873763 ACACCAGGCATGGATGGAAATGG - Intronic
1168288332 19:55345399-55345421 GCAGGAGGCTTGGCAGGAAGGGG + Intronic
925026325 2:610114-610136 GCCCCAGGCCTGGCTGGGTCTGG + Intergenic
925069056 2:951504-951526 GCACCTGGCTGGGCTCAAACTGG - Intronic
926719159 2:15946013-15946035 GCACCAGCTTTTGCTGGAAAAGG + Exonic
926952109 2:18254059-18254081 GCTCCAGGCCTGGCTGAAAGGGG + Intronic
927142542 2:20140069-20140091 GCACCCGGCTTTGCAGGGACAGG + Intergenic
927495661 2:23550022-23550044 GGACCACGCTGGGCTGGAGCAGG - Intronic
927940971 2:27102533-27102555 GCTCCTGGCCTGGCTGGAAGGGG + Exonic
928082973 2:28326507-28326529 GCACCTGGCTGGGCTGGGGCTGG - Intronic
933704515 2:85279776-85279798 ACCCCAGGCATGGCTGGAGCAGG + Intronic
933722528 2:85407423-85407445 CCACCATGCCTGGCTGGCACTGG - Intronic
934569174 2:95357795-95357817 GCACCAGGCTGGGGTGTGACTGG - Intronic
934920424 2:98339965-98339987 CCACCAGGCCAGGCTGGAGCTGG + Intronic
936470105 2:112791346-112791368 GCTCCAGCCTTGGCTCAAACGGG + Intergenic
937009786 2:118552196-118552218 GCATCAGGCTGGGCTGAGACAGG + Intergenic
937743319 2:125381508-125381530 GCACCAGGCTTGCCTGGGGAAGG + Intergenic
939752446 2:146064183-146064205 GCTCCAGCCTTGGCTGAAAGGGG - Intergenic
940928495 2:159396149-159396171 GCATAATGGTTGGCTGGAACAGG + Intronic
942230013 2:173852002-173852024 GCACCATGTTTAGCTGGAAGTGG + Intergenic
942715800 2:178890454-178890476 TCAAGAGGCTTGGCTGGAGCTGG - Intronic
947509811 2:230741458-230741480 GCCCCTGGCTTGGCTTGGACTGG + Intronic
947516885 2:230813775-230813797 TCTGCAGGCCTGGCTGGAACTGG + Intronic
948389393 2:237601206-237601228 GCACAAAGCTTGGCTGGATTGGG - Intronic
948438489 2:237969668-237969690 GCAGCAGACTTGGCTGGGAAGGG + Intronic
1170369336 20:15631687-15631709 GCACCAAGAGTGGCTGGAAAAGG + Intronic
1170926413 20:20728649-20728671 GCACCAGGCATGCTTGAAACAGG - Intergenic
1171335973 20:24385916-24385938 GCACAAGGCTTGTGTGGAAGGGG + Intergenic
1171997984 20:31747843-31747865 GCCCCAGGCATGGTGGGAACTGG - Intronic
1172484301 20:35289007-35289029 GCCCCAGGTTTGGCTGGATGTGG - Intronic
1172502660 20:35437871-35437893 GTACCTGGCTTGGCTGGACCTGG - Exonic
1172773118 20:37392973-37392995 GAACCAGGTCTGGCTGGAGCGGG - Intronic
1173872375 20:46350185-46350207 GCACCAGGCCAGCCTGGGACTGG - Exonic
1175626277 20:60490603-60490625 GCACCAGCCCTGGCTGCAGCTGG - Intergenic
1175988012 20:62773817-62773839 GCACAAGGCTGGGCTGGACTGGG - Intergenic
1177212014 21:18083172-18083194 GCAACAGCCATGGCTGGAGCTGG - Intronic
1178004112 21:28197024-28197046 GCTCCAGGCATGGCTGAAAGGGG - Intergenic
1180203871 21:46244855-46244877 GCACCTGGCCTGGCTGAAGCAGG - Exonic
1180825249 22:18856958-18856980 AAACCATGCTTGGCTGGACCAGG + Intronic
1180946117 22:19694515-19694537 GCACCAGCCTTCACTGGAGCCGG + Intergenic
1181187480 22:21117589-21117611 AAACCATGCTTGGCTGGACCAGG - Intergenic
1181211718 22:21292904-21292926 AAACCATGCTTGGCTGGACCAGG + Intergenic
1181397790 22:22633982-22634004 AAACCATGCTTGGCTGGACCAGG - Intergenic
1181500535 22:23313352-23313374 AAACCATGCTTGGCTGGACCAGG - Intronic
1181651621 22:24262076-24262098 AAACCATGCTTGGCTGGACCGGG + Intergenic
1181705756 22:24648663-24648685 AAACCATGCTTGGCTGGACCAGG - Intergenic
1182070475 22:27459910-27459932 CTAATAGGCTTGGCTGGAACAGG + Intergenic
1183605400 22:38864747-38864769 GTTCCAGGCGTGGCTGGAGCTGG - Exonic
1183664318 22:39238666-39238688 GCCCCATGGTGGGCTGGAACAGG - Intronic
1203215235 22_KI270731v1_random:2528-2550 AAACCATGCTTGGCTGGACCAGG - Intergenic
1203275398 22_KI270734v1_random:82861-82883 AAACCATGCTTGGCTGGACCGGG + Intergenic
950448399 3:13051692-13051714 GCCTCAGGCTCAGCTGGAACTGG + Intronic
951576299 3:24117703-24117725 GCTTCAGGCATGGCTGGATCTGG - Exonic
952961031 3:38589186-38589208 GGAACAGGCGTGGCTGGAACAGG - Intronic
953136896 3:40189504-40189526 GCCCTAGGCTTGCCTGGAAGGGG - Intronic
953607653 3:44421950-44421972 GCACCAAGCCTTCCTGGAACAGG + Intergenic
954714820 3:52521764-52521786 GCACCAAGGGTGGGTGGAACGGG + Intronic
955103781 3:55876741-55876763 GCAGCAGGCATTGATGGAACAGG + Intronic
959754747 3:109883886-109883908 GCTCCAGGCATGGCTGAAAGGGG - Intergenic
961468649 3:127097468-127097490 GACCCTGGCGTGGCTGGAACTGG + Intergenic
962884367 3:139610234-139610256 GCACCAGACTTGACTGCACCAGG - Intronic
969624581 4:8295779-8295801 GCACCAGCCTTGGCTGCACTGGG - Intronic
970222814 4:13827824-13827846 CCTCCAGGTTTGGCTGGAAATGG + Intergenic
971224398 4:24737757-24737779 GCTCCAGTCATGGCTGGAAGGGG + Intergenic
971477067 4:27082389-27082411 GCACCAGCCTGAGCAGGAACTGG - Intergenic
973773264 4:54225434-54225456 CCACCGGGCTGGGCTGGACCAGG + Intronic
973988327 4:56377635-56377657 GCCCTAGGCTTGGATGAAACAGG + Intronic
974013016 4:56624608-56624630 GCTCCAGCCTTGGCTGAAAAGGG + Intergenic
975072459 4:70158709-70158731 GCAGCAGGCTCAGCTGCAACAGG - Exonic
975072466 4:70158769-70158791 GCAGCAGGCTCAGCTGCAACAGG - Exonic
975072476 4:70158844-70158866 GCAGCAGGCTTGGCTGTAGCAGG - Exonic
976607614 4:86997197-86997219 CCACCACGCTTGGCCTGAACTGG + Intronic
977471355 4:97447558-97447580 GCTCCAGCCTTGGCTAAAACGGG + Intronic
981310609 4:143294519-143294541 GGACCAGCCGTGGATGGAACAGG - Intergenic
982018921 4:151184167-151184189 CCCCAAGGCTTGACTGGAACCGG + Intronic
984427696 4:179608863-179608885 TCACCAGGCTGGTCTCGAACTGG - Intergenic
985767764 5:1789084-1789106 GCACCAGGGTTGGCTGGTGAGGG + Intergenic
986417969 5:7547359-7547381 GCACCAGGCCTGGGTGGCATGGG + Intronic
987283557 5:16435337-16435359 GCAGTAGCCATGGCTGGAACTGG - Intergenic
988122713 5:26988163-26988185 GCACCAAGCGTGGCTGGATGTGG - Exonic
992842740 5:80712046-80712068 GAATCAGGCATGGCTGGAATTGG + Intronic
993109960 5:83644585-83644607 GCAGCAGGCGTGTCTGGACCAGG - Exonic
996030942 5:118703343-118703365 GCTCCAGCCTTGGCTGAAAGGGG - Intergenic
996050264 5:118924351-118924373 GCTTCAGGCTTTGCTGGATCTGG - Intronic
996222800 5:120953720-120953742 GCTCCAGCCTTGGCTGAAAGGGG + Intergenic
996617379 5:125457877-125457899 GCTCCAGCCTTGGCTGAAAGTGG + Intergenic
997150189 5:131485212-131485234 CCACCATGCTTGGCTAGAAGTGG + Intronic
997248189 5:132369596-132369618 CCAGCAGGCTTGGCTGGCAGAGG + Intergenic
997360607 5:133292318-133292340 CCACCAGGCCTGCCTGGAAGGGG + Intronic
999329007 5:150660270-150660292 TCACCAGGGGTGGCTGGATCAGG - Intergenic
1000684000 5:164224459-164224481 GCAGCAGGACTAGCTGGAACTGG - Intergenic
1000751126 5:165097713-165097735 GCACCAGCCGTGGCTGAAAGGGG - Intergenic
1003630122 6:7779221-7779243 GCACCATGGTTGCCTGGCACTGG - Intronic
1004331370 6:14724992-14725014 CCACCAAGCTTGGCTGAAATTGG - Intergenic
1004592787 6:17069876-17069898 GCTCCAGCCTTGGCTGAAAGGGG + Intergenic
1005499921 6:26420967-26420989 GAAGCAGGCATGGCTGGAGCGGG - Intergenic
1007340232 6:41186556-41186578 TGACCAGGCCTGCCTGGAACCGG + Intergenic
1007777664 6:44232821-44232843 GCACCAGGCTTGGCAGCCAGCGG - Exonic
1016082739 6:139875986-139876008 GCACCTCGCATGGCTGGAGCAGG - Intergenic
1018013520 6:159693036-159693058 GCACCGGGCCTGGCGGGACCGGG - Intronic
1018064605 6:160116482-160116504 GCACCAGGCTTGGCCTGGACAGG + Intergenic
1019092005 6:169545406-169545428 CCACCAGGCTTGGCTGGATGAGG - Intronic
1019372805 7:671825-671847 GCCCCAGCCATGCCTGGAACGGG + Intronic
1020445177 7:8261446-8261468 GCGCCAGGGTTTGCTGGAACCGG + Intronic
1020782718 7:12536361-12536383 GCTCCAGCCATGGCTGGAAGAGG - Intergenic
1021036858 7:15810072-15810094 GCTCCAGCCTTGGCTGAAAGGGG - Intergenic
1022652521 7:32290199-32290221 GCACCCGGCTTGGCTGAGACAGG + Intronic
1022773431 7:33499391-33499413 GCAATAGGCTGTGCTGGAACAGG - Intronic
1023774863 7:43595561-43595583 GCACCATGCCTGGCTTCAACTGG + Intronic
1024938225 7:54734426-54734448 GCAGAAAGCTTGGCTGGGACTGG - Intergenic
1026205072 7:68250198-68250220 ACACATGGCTGGGCTGGAACCGG + Intergenic
1029917913 7:104231165-104231187 GCACCAGGGTTGGGTGGATGGGG - Intergenic
1033422949 7:141218871-141218893 GGAGCAGGCTGGGCTAGAACTGG - Intronic
1034345455 7:150382670-150382692 GCACCAGGCTTGCCGGACACAGG + Intronic
1034499205 7:151439402-151439424 GCACCAGGCACGGCTGGTAGAGG + Intronic
1035067669 7:156120066-156120088 GCACCAGGCTTGAGTGGCAAAGG - Intergenic
1035681175 8:1489313-1489335 GCACCATGCGTGGATGGCACCGG + Intergenic
1039435440 8:37556526-37556548 GCTCCAGGGCTGGCTGGAGCTGG - Intergenic
1045247986 8:100460050-100460072 GCCCCAGGCGTGGAAGGAACAGG + Intergenic
1048325750 8:133437595-133437617 GCTCCAGCCAAGGCTGGAACGGG + Intergenic
1049269206 8:141685240-141685262 GCACCAGGCTGGTGTGGAACAGG - Intergenic
1049320285 8:141992577-141992599 GCAGCAGGCCTGCCTGGATCAGG + Intergenic
1050931310 9:11330678-11330700 GCACCAGGCAGGGGTGGAGCTGG - Intergenic
1056180835 9:84080628-84080650 CCACCACGCTGGGCTGGAACTGG + Intergenic
1056694230 9:88832813-88832835 GCACTTCGCATGGCTGGAACAGG + Intergenic
1057035745 9:91810733-91810755 TCACCAGGTGTGGCCGGAACAGG + Intronic
1057851778 9:98571711-98571733 ACAGCAGGCCTGGCTGAAACTGG + Intronic
1057995207 9:99816728-99816750 CCACCATGCCTGGCTGGAATAGG - Intergenic
1061075083 9:128336262-128336284 GCATCAGGCTTAGCTGGGAATGG + Intergenic
1062042523 9:134410686-134410708 GCCCGAGGCGTGGCTGGAGCTGG + Intronic
1062532015 9:137006198-137006220 GGACCAGGCCAGGCTGGACCTGG - Intergenic
1185892749 X:3835414-3835436 GCAGCAGGCGTGGCGGGCACGGG + Intronic
1185897857 X:3873834-3873856 GCAGCAGGCGTGGCGGGCACGGG + Intergenic
1185902976 X:3912265-3912287 GCAGCAGGCGTGGCGGGCACGGG + Intergenic
1186742591 X:12534110-12534132 GCGCCAGCCTTGGCTGAAAGGGG + Intronic
1187677746 X:21734606-21734628 GCCCCAGTCCAGGCTGGAACTGG - Intronic
1189717654 X:43882309-43882331 GCACCAGGGAGGCCTGGAACGGG - Exonic
1190053548 X:47169517-47169539 GCGCCAGGCCTGGCTGGGATGGG + Intronic
1190790553 X:53696144-53696166 GAAGCAGGCTAGGCTGGAGCAGG - Intergenic
1193438970 X:81515502-81515524 GCTCCAGCCTTGGCTGAAAGTGG + Intergenic
1193807989 X:86016481-86016503 GCTCCAGCCTTGGCTGAAAGGGG + Intronic
1194397837 X:93407856-93407878 GCACCAGTTTTGGCTGGGTCTGG + Intergenic
1194872192 X:99146380-99146402 GCAGCCTGCTTGGCTGGAATTGG + Intergenic
1195289016 X:103413890-103413912 GCACACTGCTTGGCTGCAACAGG + Intergenic
1199292009 X:146114630-146114652 GCAGCTGGCCTGGCTGGAATTGG - Intergenic
1200069709 X:153522112-153522134 GTGCCAGGCTGGGCTTGAACGGG + Intronic
1201354218 Y:13081301-13081323 GCAGCCTGCTTGGCTTGAACTGG + Intergenic