ID: 1067567449

View in Genome Browser
Species Human (GRCh38)
Location 10:47349277-47349299
Sequence GACCTCCGGAAGCTGAGGAT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 144}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067567436_1067567449 15 Left 1067567436 10:47349239-47349261 CCATCGTGGTGGGCGAGCGGACT 0: 1
1: 0
2: 0
3: 1
4: 23
Right 1067567449 10:47349277-47349299 GACCTCCGGAAGCTGAGGATAGG 0: 1
1: 0
2: 2
3: 12
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067567449 Original CRISPR GACCTCCGGAAGCTGAGGAT AGG Exonic
900653611 1:3743938-3743960 GACCTCTGTAGGCTGAGGAAGGG - Intergenic
900746069 1:4361539-4361561 AACCTCCGGAACCTGTGAATGGG + Intergenic
902648765 1:17822965-17822987 GACCTGCGGAAGCAAAGGATGGG - Exonic
909393062 1:75136965-75136987 GACCTCAAGAAGCTGGGGGTGGG + Intronic
910444781 1:87288990-87289012 AACCTCAGGAAGATGAGGCTGGG - Intergenic
917484597 1:175444247-175444269 GACCCCTGCAAGATGAGGATGGG + Intronic
919412269 1:197260040-197260062 GTACTCCAGAAGCTGAGGTTGGG + Intergenic
1062964259 10:1595100-1595122 GTCATACGGAAGCTGAGGCTTGG + Intronic
1066125306 10:32335984-32336006 GACATCCGGGAGCTGATGAATGG - Intronic
1066285762 10:33964524-33964546 CACCTCATGAAGCTGCGGATGGG + Intergenic
1066475331 10:35741409-35741431 GACATCCGAAAGATGATGATGGG + Intergenic
1067567449 10:47349277-47349299 GACCTCCGGAAGCTGAGGATAGG + Exonic
1068385857 10:56326703-56326725 GACCTTCTGAACCTGAGAATTGG + Intergenic
1070842212 10:79495052-79495074 AGCCTCTGGTAGCTGAGGATGGG - Intergenic
1074521037 10:114224093-114224115 GTCCTCCAGAAGCTGAGAAAAGG + Intronic
1075187451 10:120275892-120275914 GACCTCTGGTAGATGAGGACAGG + Intergenic
1075862440 10:125688838-125688860 GACCTCATGAAGCTGAGGTAAGG + Intergenic
1076349478 10:129806060-129806082 GCCCTTCTGAAGCTTAGGATTGG - Intergenic
1078628370 11:12979306-12979328 GACCTCAGGAAGGTGAGCCTGGG - Intergenic
1083190640 11:61049683-61049705 CTCCTCGGGAAGCTGAGGATGGG - Intergenic
1085265993 11:75238479-75238501 GACCCCAAGAAGCTGAGGCTGGG - Intergenic
1085384160 11:76147179-76147201 GACCGCCTGAAGCTAAGGAGAGG + Intergenic
1085762413 11:79253486-79253508 GACCTCCGGAGGCTCACAATAGG + Intronic
1088990517 11:114949572-114949594 GGCCTCCTGAAACTCAGGATGGG - Intergenic
1089191316 11:116655427-116655449 GACCTCAAGAAGCTCAGGATGGG - Intergenic
1090838714 11:130472056-130472078 GACCTCAGGAAGCTCAAGCTGGG - Intronic
1091406951 12:214964-214986 GTCCTCTGGAAGCAGAGGCTGGG + Intergenic
1094461600 12:30702491-30702513 GAGGTCCTGAAGCTGAGGAAGGG - Intergenic
1096595941 12:52695587-52695609 GACCTGGGGATTCTGAGGATTGG + Intronic
1102033760 12:109759439-109759461 GCCTTCCAGAAGCTGAGGAGGGG - Intronic
1102796573 12:115694118-115694140 AACCTCATGAAGCTGAGGCTTGG + Intergenic
1103964035 12:124626690-124626712 GACCTCCAGAAGCTGACAATTGG + Intergenic
1104932100 12:132345276-132345298 GAGCTCCGGACGCTGAGTGTGGG - Intergenic
1105599433 13:21872905-21872927 ATCCTCCGGAGGCTGTGGATGGG - Intergenic
1106116605 13:26822927-26822949 GAACTCGGGAAGCAGAGGCTGGG + Intergenic
1109505949 13:63303723-63303745 GACCTGCGTAAGCTTAGGCTAGG + Intergenic
1110497664 13:76188506-76188528 GAGCTCCTGAAGCTGAGAATAGG - Intergenic
1120203062 14:81559536-81559558 GCCCCCCAGAAGCTGAGGAGAGG - Intergenic
1121957991 14:98231439-98231461 GTCCTGGGGAGGCTGAGGATGGG + Intergenic
1123680488 15:22759528-22759550 GACCTCCAGATGCTGAGGCTAGG + Intergenic
1124332706 15:28833985-28834007 GACCTCCGGATGCTGAGGCTGGG + Intergenic
1124577585 15:30923481-30923503 GACCTCTGGAAACAGAGGTTAGG - Intronic
1127781181 15:62317729-62317751 GATCCCAGGAAGCGGAGGATGGG + Intergenic
1130283946 15:82540361-82540383 GACCGCGGGAAGCTGCAGATGGG + Intronic
1130751375 15:86716617-86716639 GACATCTGAAAGCTGAGTATTGG - Intronic
1131322041 15:91403402-91403424 GACCTCCAGAAGCTGGGGAATGG - Intergenic
1132579163 16:677298-677320 GCCCTCCTGCAGCTGATGATCGG + Exonic
1135726563 16:24858609-24858631 GACCTCTGGATCCTGAGGAAGGG - Exonic
1137734098 16:50711492-50711514 GACCTTGGGAAGCTGAGTCTGGG - Exonic
1140738777 16:77923114-77923136 GTCCTCCAGAAGCCGAGGTTCGG - Intronic
1142891725 17:2948283-2948305 CACCTCCAGAAGCAGAGGAGAGG + Intronic
1143563743 17:7709404-7709426 GACCTCGGGAGGCTGAGCCTGGG + Exonic
1144776727 17:17788525-17788547 GGGCTCCAGAAGCTGAGGACAGG - Intronic
1144857956 17:18280733-18280755 GTCCTCGGGCAGCTGAGGAAAGG - Intronic
1147109365 17:38250464-38250486 GAACTCAGGAAGCGGAGGAGCGG - Intergenic
1147200620 17:38799282-38799304 CACATCAGGACGCTGAGGATCGG + Exonic
1147600756 17:41743855-41743877 GTCCTCAGGGAGCTGAGGATTGG - Intergenic
1148420084 17:47537612-47537634 GAACTCGGGAAGCGGAGGAGCGG + Intronic
1149278940 17:55080063-55080085 GACCTTGGAAAGCTGAGGGTGGG - Intronic
1151785122 17:76271664-76271686 GCCCCCGGGAAGCTGAGGAGAGG - Intergenic
1152120201 17:78413799-78413821 GACCTCGGGAAGTTGTGGAACGG + Intronic
1152135216 17:78499693-78499715 CCCCTCCTGAGGCTGAGGATGGG - Intronic
1152791648 17:82283352-82283374 GACCTCTGGGAGCTGGGGACAGG - Intergenic
1153122446 18:1745654-1745676 TCCCTCAGGATGCTGAGGATGGG - Intergenic
1154030886 18:10753385-10753407 GACCTCCAGAAACAGAGTATTGG - Intronic
1155538368 18:26841108-26841130 GACCTCTGGAAGCTGAATGTGGG - Intergenic
1156094715 18:33515812-33515834 AACTGCTGGAAGCTGAGGATAGG + Intergenic
1156354924 18:36332637-36332659 GAACTCCTCAAGCTGTGGATGGG - Intronic
1156593266 18:38516473-38516495 GCCCTCTGGAAGCTCAGCATTGG - Intergenic
1160091064 18:75826940-75826962 GACCCCCAGGAGCTGAGGAAAGG - Intergenic
1164589446 19:29498308-29498330 GACCTCAGGGGGCTGAGGACTGG + Intergenic
924999912 2:396583-396605 TACCTGCGGAAGCTAAGGAAGGG + Intergenic
926705620 2:15835402-15835424 CACCTCCAGAAGCTGGGGAGAGG - Intergenic
927666141 2:25034332-25034354 GAGATTTGGAAGCTGAGGATTGG + Intergenic
930099769 2:47594319-47594341 GTTCTCCGGGAGCTGAAGATGGG - Intergenic
930682821 2:54275358-54275380 AACCACAGGAAACTGAGGATTGG + Intronic
942795989 2:179819639-179819661 GCCCTCCGAAAGTTGAGGATGGG + Intronic
948635473 2:239331820-239331842 GTCCTCCAGAGGCTGAGGAGCGG + Intronic
1168866475 20:1091060-1091082 GACCTCCTCAAGCTGAGCAAGGG - Intergenic
1171494579 20:25546931-25546953 GACATCTGCAAGCTGAGGAGAGG - Intronic
1174200528 20:48803631-48803653 GACCTCGGGAAGCTGCAGAAGGG - Intronic
1174202027 20:48813249-48813271 GACCTCGGGAAGCTGATTCTTGG - Intronic
1175933285 20:62503461-62503483 GACCCCCACAAGCTGTGGATGGG + Intergenic
1179173551 21:38991397-38991419 GGCCTCTGCAAGCTGAGGAGGGG + Intergenic
949538005 3:5010869-5010891 TACCTGAGGAAGCTGAGGCTTGG - Intergenic
954153467 3:48671550-48671572 GTCCTCAGGAAGCTGAGGCAGGG - Intergenic
956677887 3:71753152-71753174 TACCTCAGGAAGCAGAGGCTTGG - Intronic
962441268 3:135419346-135419368 GACTTCCTGCATCTGAGGATTGG - Intergenic
963748967 3:149155139-149155161 TACCTCCTGTAGCTGAGGCTGGG + Exonic
964392530 3:156212666-156212688 GACCTCCAGAAATTGATGATTGG + Intronic
968070044 3:195779111-195779133 GACCTGAGGATGCTGAGGAAGGG + Exonic
968070088 3:195779351-195779373 CACCTCTGGATGCTGAGGAAGGG + Exonic
968070116 3:195779495-195779517 GACCTGTGGATGCTGAGGAAGGG + Exonic
968070145 3:195779639-195779661 GACCTGTGGATGCTGAGGAACGG + Exonic
968070196 3:195779927-195779949 CACCTGTGGAAGCTGAGGAAAGG + Exonic
968070208 3:195779975-195779997 GACCTGTGGATGCTGAGGAAGGG + Exonic
968070279 3:195780359-195780381 GACCTGTGGATGCTGAGGAAGGG + Exonic
968070463 3:195781319-195781341 GACCTGTGGATGCTGAGGAAGGG + Exonic
968070489 3:195781463-195781485 CACCTGTGGAAGCTGAGGAAAGG + Exonic
968070580 3:195781991-195782013 GACCTGTGGATGCTGAGGAAGGG + Exonic
968070625 3:195782231-195782253 GACCTGTGGATGCTGAGGAAGGG + Exonic
968070774 3:195783047-195783069 GACCTGAGGATGCTGAGGAAGGG + Exonic
968070797 3:195783191-195783213 GACCTGTGGATGCTGAGGAAGGG + Exonic
968070879 3:195783671-195783693 GACCTGTGGATGCTGAGGAAGGG + Exonic
968070922 3:195783911-195783933 GACCTGTGGATGCTGAGGAAGGG + Exonic
968070991 3:195784295-195784317 CACCTGTGGAAGCTGAGGAAAGG + Exonic
968071037 3:195784535-195784557 GACCTGTGGATGCTGAGGAAGGG + Exonic
968071063 3:195784679-195784701 GACCTGTGGATGCTGAGGAAGGG + Exonic
968071106 3:195784919-195784941 GACCTGTGGATGCTGAGGAAGGG + Exonic
968071183 3:195785351-195785373 GACCTGTGGATGCTGAGGAAGGG + Exonic
968071254 3:195785735-195785757 GACCTGAGGATGCTGAGGAAGGG + Exonic
968071360 3:195786359-195786381 GACCTGTGGATGCTGAGGAAGGG + Exonic
968071408 3:195786599-195786621 GACCTGTGGATGCTGAGGAAGGG + Exonic
968071492 3:195787031-195787053 GACCTGTGGATGCTGAGGAAGGG + Exonic
968071546 3:195787367-195787389 GACCTGTGGATGCTGAGGAAGGG + Exonic
968071599 3:195787655-195787677 GACCTGTGGATGCTGAGGAAGGG + Exonic
968071653 3:195787991-195788013 GACCTGTGGATGCTGAGGAAGGG + Exonic
974178303 4:58353440-58353462 GACCTAAGGAAGCTAAAGATGGG + Intergenic
981141453 4:141274381-141274403 GACTTCCTGATGCTGAGGTTTGG - Intergenic
986284413 5:6348907-6348929 AGCCTCCTGAAGCTGAGGACCGG - Intergenic
986391486 5:7291497-7291519 GACCTCCGGATGCTGAGGCTAGG + Intergenic
988183199 5:27825126-27825148 GTACTCAGGAAGCTGAGGCTGGG + Intergenic
993606388 5:89995322-89995344 GACCTTCTGAAGGTGAGGATAGG + Intergenic
994020985 5:95025747-95025769 GACTTCAGGAATCTGAGGGTAGG + Intronic
996382624 5:122877621-122877643 GTCCTCCTGAAGCTGGGGAGTGG - Intronic
997367430 5:133334979-133335001 TACCTCTGGGAGCTGAGTATTGG - Intronic
999690096 5:154139148-154139170 GACTTCTGGAAGCTGCTGATGGG - Intronic
999773874 5:154795546-154795568 TACCTGCCGAAGCTGATGATGGG - Intronic
1002810191 6:621020-621042 GACCACTGGAGGCTGAGGAGTGG - Intronic
1003474053 6:6465165-6465187 GTCCTCGGGAAGCTGAGTTTGGG + Intergenic
1005258353 6:24029295-24029317 GAGCTCCGGAGGCCAAGGATGGG - Intergenic
1009995518 6:70891129-70891151 CACCTCAGGAATCTGAGGATTGG - Intronic
1013551990 6:111216986-111217008 GACCTACGGAAGCTGGAGGTTGG - Intronic
1015579357 6:134706503-134706525 GAGCTCCTGAAGTTGAGGAAGGG - Intergenic
1019261863 7:86344-86366 GAGCTCAGGAGGATGAGGATGGG - Intergenic
1019346696 7:534426-534448 GACATCTGGAAGGTGAGGATGGG + Intergenic
1034010133 7:147520839-147520861 GGTCTACGGAAGCTGAGCATGGG - Intronic
1036291265 8:7493615-7493637 GAGCCCCGGAGGCAGAGGATGGG - Intergenic
1036330224 8:7817921-7817943 GAGCCCCGGAGGCAGAGGATGGG + Intergenic
1036676585 8:10839376-10839398 AACCTCAGGAAGCTGAGGTCCGG + Intronic
1037608401 8:20456563-20456585 GTACTCCGGAGGCTGAGGTTGGG - Intergenic
1037784562 8:21894937-21894959 GGCCTCTGGGAGCTGAGGACTGG + Intergenic
1039303063 8:36231144-36231166 GATCTGGGGAAGCTGAGGAAGGG - Intergenic
1047541469 8:125770605-125770627 GTCCTTCGGAACTTGAGGATAGG - Intergenic
1051416858 9:16850685-16850707 TACCTCAGGAAGCTGAGGTAGGG + Intronic
1051602104 9:18885644-18885666 GACCCCTGGAAGCTCAGTATGGG - Intronic
1053397144 9:37785376-37785398 GATCTCTGGAAGCTGAGCAGAGG + Intronic
1057856364 9:98604021-98604043 GACAGCTGGAAGCTGAGGCTTGG + Intronic
1061117852 9:128625967-128625989 CACTTCCGCAAGGTGAGGATGGG + Exonic
1061188733 9:129069928-129069950 GACTTCAGCAAGCTGAGGCTTGG - Exonic
1061416192 9:130448163-130448185 GACCTGCGGAGGCTGAGGGAGGG + Intronic
1062122041 9:134839064-134839086 GACCTCCGGGGGCTGAGGCAGGG - Intronic
1187442316 X:19331597-19331619 GACCTCCAGAAGCTGAAGTCGGG + Intergenic
1189195309 X:39147580-39147602 GTCCTCCCGAAGCAGAGCATAGG + Intergenic
1190930281 X:54943118-54943140 GACTTCCTGAATCTGAGGACTGG - Intronic
1191258645 X:58290888-58290910 GACCTCTGGAAGATGGGGACAGG + Intergenic
1197674794 X:129317656-129317678 GACCTCTGGAAGCTTTTGATTGG - Intergenic
1199360943 X:146917834-146917856 GACTTCCTGAAGCTGAAAATTGG - Intergenic
1199460598 X:148080119-148080141 GACTTCCTGGATCTGAGGATTGG - Intergenic