ID: 1067567536

View in Genome Browser
Species Human (GRCh38)
Location 10:47349656-47349678
Sequence GGCCCACAGAAACTCCTTCT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 188}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067567527_1067567536 24 Left 1067567527 10:47349609-47349631 CCTGCAGGCTGCGTCTGAGGATC 0: 1
1: 0
2: 0
3: 7
4: 113
Right 1067567536 10:47349656-47349678 GGCCCACAGAAACTCCTTCTTGG 0: 1
1: 0
2: 0
3: 11
4: 188
1067567530_1067567536 2 Left 1067567530 10:47349631-47349653 CCCAGGCTCCTGGTGCGAGCCAT 0: 1
1: 0
2: 0
3: 4
4: 113
Right 1067567536 10:47349656-47349678 GGCCCACAGAAACTCCTTCTTGG 0: 1
1: 0
2: 0
3: 11
4: 188
1067567534_1067567536 -6 Left 1067567534 10:47349639-47349661 CCTGGTGCGAGCCATCGGGCCCA 0: 1
1: 0
2: 4
3: 54
4: 370
Right 1067567536 10:47349656-47349678 GGCCCACAGAAACTCCTTCTTGG 0: 1
1: 0
2: 0
3: 11
4: 188
1067567531_1067567536 1 Left 1067567531 10:47349632-47349654 CCAGGCTCCTGGTGCGAGCCATC 0: 1
1: 0
2: 1
3: 8
4: 180
Right 1067567536 10:47349656-47349678 GGCCCACAGAAACTCCTTCTTGG 0: 1
1: 0
2: 0
3: 11
4: 188
1067567525_1067567536 28 Left 1067567525 10:47349605-47349627 CCGGCCTGCAGGCTGCGTCTGAG 0: 1
1: 0
2: 2
3: 27
4: 209
Right 1067567536 10:47349656-47349678 GGCCCACAGAAACTCCTTCTTGG 0: 1
1: 0
2: 0
3: 11
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067567536 Original CRISPR GGCCCACAGAAACTCCTTCT TGG Exonic
900012950 1:132038-132060 GCCCCACAGAAGCTGCTCCTTGG - Intergenic
900043016 1:488025-488047 GCCCCACAGAAGCTGCTCCTTGG - Intergenic
900792181 1:4687984-4688006 GGCCCACAGAACCTCTCCCTGGG + Intronic
902092110 1:13911858-13911880 GGCCCCCAGAAGTCCCTTCTAGG + Intergenic
902370575 1:16004410-16004432 GCCCCACAGAAACACCAGCTGGG + Intronic
904533994 1:31187161-31187183 AGCCCACACACACTCATTCTAGG - Intronic
908851321 1:68379410-68379432 CACCCACAGAAACTCCAGCTGGG - Intergenic
909723939 1:78811278-78811300 GTCCCACAAAAAATCTTTCTTGG + Intergenic
912338919 1:108890724-108890746 GTGCCACAGAAACTCCTCCAGGG - Intronic
914731466 1:150374449-150374471 GGCTCACACAACCCCCTTCTTGG - Intronic
915280237 1:154817465-154817487 AGGCCACAGCAACTCCATCTTGG - Intronic
920080166 1:203367317-203367339 GGCCAACAGAAACTGCTGCCAGG + Intergenic
920657384 1:207887018-207887040 GCCACACAGAAACTCTTTTTGGG - Exonic
920950480 1:210567709-210567731 GGGCCACAGCATCTCCATCTAGG - Intronic
922099350 1:222469036-222469058 GCCCCACAGAAGCTGCTCCTTGG - Intergenic
922261388 1:223948531-223948553 GCCCCACAGAAGCTGCTCCTTGG - Intergenic
922735686 1:227977212-227977234 GCCCCACAGAAGCTGCTCCTTGG + Intergenic
924342548 1:243050708-243050730 GCCCCACAGAAGCTGCTCCTTGG - Intergenic
1066733924 10:38454844-38454866 GCCCCACAGAAGCTGCTCCTTGG + Intergenic
1067214838 10:44293223-44293245 GGCCCACGGAAGCTCCGTGTTGG + Intronic
1067567536 10:47349656-47349678 GGCCCACAGAAACTCCTTCTTGG + Exonic
1068670599 10:59718684-59718706 GGCACAAAGAAGCTGCTTCTGGG + Intronic
1070891493 10:79944943-79944965 GGCCCACAGAGACCTATTCTGGG + Intronic
1071404591 10:85317937-85317959 GACCCACTGAAACCCTTTCTGGG - Intergenic
1072453415 10:95557090-95557112 GACCCACAGAGACACTTTCTAGG + Intronic
1076329452 10:129653968-129653990 GGCCCTCAGAGACCCCTGCTTGG + Intronic
1076691693 10:132226955-132226977 TGCCCACAGGTACTCCTTCCAGG - Exonic
1076969287 11:124242-124264 GCCCCACAGAAGCTGCTCCTTGG - Intergenic
1083333383 11:61909436-61909458 GGCCCCCAGAGACTCCTGCAAGG + Intronic
1083686035 11:64375805-64375827 GGCCTATAGAAACTCATTTTTGG + Intergenic
1087333433 11:96812789-96812811 GACCCAGAGGAACTCTTTCTTGG + Intergenic
1089070959 11:115699367-115699389 TGCCCAGAGAAACTTCTACTAGG - Intergenic
1091276967 11:134359222-134359244 GCACCAGAGAAACTCCTACTTGG - Intronic
1101367365 12:104086511-104086533 CCCCCAGAAAAACTCCTTCTAGG + Intronic
1104981191 12:132573761-132573783 GGCTCACAGCAGCTCCTCCTGGG + Intronic
1113132448 13:107053195-107053217 GGCCTAAAGCAACTCCATCTTGG + Intergenic
1114962739 14:27914482-27914504 GGTCCAGAGAAACTTGTTCTGGG - Intergenic
1115604172 14:34983336-34983358 GAGCCACAGAAACTCAGTCTCGG - Intronic
1116563611 14:46416172-46416194 GGCCCTCAGAATCTCCAACTGGG + Intergenic
1116669354 14:47821382-47821404 GGCCCACTGTAACTACTACTTGG + Intergenic
1118241116 14:64059942-64059964 GGCCCACAGAAAGTACTGCCAGG + Intronic
1118815701 14:69312402-69312424 GGCCCCAAGAAACACCCTCTGGG - Intronic
1121154590 14:91671127-91671149 GGCTGACAGAAATTCCTCCTTGG + Intronic
1122021860 14:98844652-98844674 GGTGCACAGAGACTCCTGCTGGG + Intergenic
1124613925 15:31228213-31228235 TGCACACAGAAACTCCTGGTAGG + Intergenic
1129717699 15:77861731-77861753 GGTCCAGAGAAACTTGTTCTTGG + Intergenic
1129956378 15:79640455-79640477 GGACAAAAGAAAATCCTTCTGGG - Intergenic
1131293499 15:91127655-91127677 TGCACACACAAACACCTTCTGGG - Intronic
1131360358 15:91785096-91785118 GGCCCACAGAAACTGGTTCATGG + Intergenic
1131952650 15:97697434-97697456 GGTCCAGAGCAACTCCATCTTGG - Intergenic
1132064661 15:98720893-98720915 GGCACAAGGAAACTCCTGCTTGG - Intronic
1132324709 15:100959085-100959107 GGCCAAAAGAAAATCATTCTTGG + Intronic
1132386658 15:101405529-101405551 TGCCCACAGAAGCTCCATCCAGG + Intronic
1133417474 16:5617436-5617458 GGCAGACAGAAACAGCTTCTGGG - Intergenic
1140112822 16:72018252-72018274 GTCCCTCTGAAACTCCTTCCAGG + Intronic
1141278180 16:82606692-82606714 CCCCCAAAGAAACTCCTTCATGG - Intergenic
1142451386 16:90174880-90174902 GCCCCACAGAAGCTGCTCCTTGG + Intergenic
1143233783 17:5380319-5380341 AACTCACAGAAACTCCCTCTGGG - Intronic
1144946187 17:18970725-18970747 GGCCAACAGTGACTCCTGCTGGG + Exonic
1145790788 17:27625325-27625347 GGCCCACAGAAAGTCAGTCTGGG + Exonic
1146286785 17:31579426-31579448 GGCCCACAGCATATCCTGCTTGG - Intergenic
1146494855 17:33312634-33312656 GGCCCACACTGACTCTTTCTTGG - Intronic
1147980555 17:44271411-44271433 TGCCCACAGAGTCTCCCTCTGGG - Intergenic
1149533361 17:57413440-57413462 GGCCCAAAGAGAGTTCTTCTGGG + Intronic
1152293769 17:79455044-79455066 GGCCCACAGCAACCCCTCCATGG + Intronic
1155836902 18:30596689-30596711 GTATCACAGAAACTTCTTCTAGG - Intergenic
1160646092 19:194168-194190 GCCCCACAGAAGCTGCTCCTTGG - Intergenic
1167320898 19:48796665-48796687 GGCCCGCAGCAACTGCTTCATGG + Exonic
1167648562 19:50718356-50718378 GGCCCGCAGACACTCCCCCTCGG + Intronic
926406011 2:12553713-12553735 GTCCAACAGAAACTCTTTTTGGG - Intergenic
927967637 2:27281488-27281510 GGCCTAAAGAAATTGCTTCTTGG + Intronic
928265130 2:29804741-29804763 GGGCTAAAGAAACTCCATCTTGG + Intronic
931012188 2:57929706-57929728 GGCCCACAGAAAGTACTGCCTGG + Intronic
932465901 2:71923968-71923990 TGCACACAGCACCTCCTTCTGGG - Intergenic
935465338 2:103389846-103389868 GGCCCAGAGAATCTCTCTCTGGG + Intergenic
935806763 2:106756617-106756639 AGCCCAGAGAGACTCATTCTGGG - Intergenic
936110623 2:109661544-109661566 GGCCCATAGAACCTTCTACTTGG - Intergenic
941009981 2:160288450-160288472 GCCCAACTGTAACTCCTTCTGGG + Intronic
942118960 2:172757855-172757877 GTGCCAAAGAAACACCTTCTAGG + Intronic
943022583 2:182592982-182593004 GGTCAACTGAACCTCCTTCTAGG - Intergenic
944226754 2:197355933-197355955 TGCCCACAGAAACTTTTTCTGGG - Intergenic
946741435 2:222806190-222806212 GGCCCACAGAAAATCAGTGTCGG - Intergenic
948573775 2:238936750-238936772 GACCCACAGCAAGTCCATCTTGG + Intergenic
1168993801 20:2117146-2117168 GGTCCCCAGGAGCTCCTTCTTGG - Exonic
1169014575 20:2281125-2281147 GACACACTGTAACTCCTTCTTGG + Intergenic
1169660353 20:7972365-7972387 GGCCCACAGAGAGCTCTTCTTGG + Intergenic
1169832539 20:9839614-9839636 GCCCCACAAACACTCCTTCCAGG - Intergenic
1170062858 20:12277170-12277192 GGCCCACAGCAAGTACTGCTTGG - Intergenic
1170376974 20:15710867-15710889 GGCCCCCAGAGACTACTTTTGGG + Intronic
1170987821 20:21274458-21274480 GCCCCACAGAACATCCTTTTGGG - Intergenic
1172061305 20:32189226-32189248 GGCCCACGGAGACCCCTTCTAGG - Intergenic
1172132093 20:32662524-32662546 GGCTCACCGCAACTCCGTCTCGG - Intergenic
1172339199 20:34143055-34143077 GGCTTACAGAAACCACTTCTTGG - Intergenic
1175493851 20:59399010-59399032 GACCCCCAGAGACTCCTGCTAGG - Intergenic
1175603344 20:60292698-60292720 AGCACACAGAAACCCCTTCAAGG - Intergenic
1175728617 20:61336529-61336551 GGCCCACAAAAATGCCTTCCAGG - Intronic
1176279415 20:64292048-64292070 GCCCCACAGAAGCTGCTCCTTGG + Intergenic
1176306555 21:5126582-5126604 GGGCAACAGAAGCTCCTCCTGGG + Intronic
1176372963 21:6073611-6073633 GGCCCCCACACACTCCTTCAAGG - Intergenic
1179680309 21:43016101-43016123 GGCCCACAGAATCACCGCCTTGG + Intronic
1179750514 21:43464632-43464654 GGCCCCCACACACTCCTTCAAGG + Intergenic
1179850504 21:44135448-44135470 GGGCAACAGAAGCTCCTCCTGGG - Intronic
1182779892 22:32859217-32859239 GGTCCAGAGACACTCGTTCTTGG - Exonic
1183499352 22:38169123-38169145 GACTCAAAGAAACTGCTTCTCGG + Intronic
949334088 3:2954518-2954540 AGTCCACAGAGAATCCTTCTCGG + Intronic
949541615 3:5036889-5036911 GGTCCCCAGATTCTCCTTCTAGG + Intergenic
950706256 3:14784341-14784363 GGCCCACCCAATCTCCTTCCTGG - Intergenic
950720214 3:14877212-14877234 GGCACGCAGAAACTGCTTCTGGG - Intronic
951453167 3:22862378-22862400 GGCCCACAGACCCTTCTCCTTGG - Intergenic
952900294 3:38107960-38107982 GTTCACCAGAAACTCCTTCTTGG - Intronic
953412825 3:42699799-42699821 GGCCCACAGGAAGGCCTTCCGGG - Exonic
953579843 3:44144053-44144075 GTCCCATAGAAACTGCTGCTGGG + Intergenic
953822651 3:46221857-46221879 GGCCCAGACACACTCCTTCATGG - Intronic
959385538 3:105701179-105701201 TGCACACATAAACTCCTTCCTGG + Intronic
960355137 3:116642845-116642867 TGGCCACAGAACCTCCTTATAGG + Intronic
961314670 3:126026375-126026397 GGCACACAGCAACTCCACCTTGG + Exonic
961319451 3:126062904-126062926 TGCCCCCAGAAACGCCTTCATGG + Intronic
961351493 3:126307343-126307365 GGCTCACAGGGACTCCCTCTGGG + Intergenic
962348586 3:134640541-134640563 GGCCCCCAGAGAAGCCTTCTTGG - Intronic
963859743 3:150296774-150296796 GGCCTACAGAATCCCATTCTAGG - Intergenic
964471877 3:157065063-157065085 GGGCCACTGTAACTCTTTCTGGG - Intergenic
966400972 3:179546679-179546701 GGCCCACAGGAAGTACTTCCAGG - Intergenic
967120546 3:186378825-186378847 GGCCACCAGCAACACCTTCTAGG - Intergenic
968371589 3:198225358-198225380 GCCCCACAGAAGCTGCTCCTTGG + Intergenic
968683275 4:1936905-1936927 GGCCCACAGAACATTCTTCTGGG + Intronic
968879289 4:3290987-3291009 CTCCCACAGAAACAGCTTCTTGG + Intergenic
970652558 4:18194685-18194707 GGATGACAGAAACTCCTGCTTGG + Intergenic
973998084 4:56480280-56480302 GGGCAACAGAGACTCCATCTTGG - Intronic
974867971 4:67603523-67603545 GGCCCACAGCAAGTACTGCTTGG + Intronic
979260274 4:118637833-118637855 GCCCCACAGAAGCTGCTCCTTGG + Intergenic
979478362 4:121184802-121184824 GGCCTACAGCAAATCCTTCATGG + Intronic
981441172 4:144783996-144784018 TGGCCTCTGAAACTCCTTCTGGG + Intergenic
981444330 4:144818252-144818274 GGCCCACAAAAAGTCCTGCAGGG + Intergenic
982640640 4:157955173-157955195 TACCCACAGAAACTTCTACTTGG + Intergenic
984748310 4:183245590-183245612 GGCCCCCAGAAACTCTTACTGGG + Intronic
986000900 5:3629792-3629814 TGACCACACAAATTCCTTCTAGG + Intergenic
988117934 5:26920531-26920553 GGCCCACAGTAACCACTGCTTGG - Intronic
988514185 5:31890753-31890775 GTTCCAGAGAAACTCCTCCTTGG - Intronic
988608529 5:32703498-32703520 GGCCCACAGCAAATACTTCCTGG + Intronic
990685905 5:58300797-58300819 AGGCTACAGAAACACCTTCTAGG + Intergenic
995554604 5:113314531-113314553 GTTCCCCTGAAACTCCTTCTTGG - Intronic
999456114 5:151717584-151717606 GGGCCACAGTAACTCTTTCAGGG + Intergenic
1001096632 5:168780367-168780389 GGCCCACAGAGTATCTTTCTTGG - Intronic
1001490404 5:172150839-172150861 GGCCCACAGTCACTCCTTCAGGG + Intronic
1002730827 5:181330904-181330926 GCCCCACAGAAGCTGCTCCTTGG + Intergenic
1002753704 6:143200-143222 GCCCCACAGAAGCTGCTCCTTGG - Intergenic
1003424459 6:5988619-5988641 CTCCCTCAGAAACTCCTCCTAGG - Intergenic
1009744932 6:67799625-67799647 GGCCCACAGTAACTACTGCCTGG - Intergenic
1013275772 6:108583446-108583468 GGCACACAGTAACTAATTCTTGG - Intronic
1015527002 6:134183750-134183772 GGCCTCCAGAAGTTCCTTCTGGG - Intronic
1015942475 6:138466021-138466043 GCCCCACATACACTCCTTTTTGG + Intronic
1019273181 7:161991-162013 GGCCCACAGGTGCTGCTTCTGGG - Intergenic
1019401459 7:856534-856556 TGCCGACAGACACTCCTGCTGGG + Intronic
1019765723 7:2848884-2848906 GGCCCACAGACATGCTTTCTTGG + Intergenic
1023401993 7:39797434-39797456 GCCCCACAGAAGCTGCTCCTTGG + Intergenic
1024075970 7:45818064-45818086 GCCCCACAGAAGCTGCTCCTTGG + Intergenic
1025051464 7:55737720-55737742 GCCCCACAGAAGCTGCTCCTTGG - Intergenic
1025128427 7:56363388-56363410 GCCCCACAGAAGCTGCTCCTTGG - Intergenic
1025176815 7:56806269-56806291 GCCCCACAGAAGCTGCTCCTTGG - Intergenic
1025694978 7:63770117-63770139 GCCCCACAGAAGCTGCTCCTTGG + Intergenic
1026525560 7:71150453-71150475 GGCCCACCAAAACTCCTACGGGG + Intronic
1027776287 7:82469339-82469361 GGCCCACAGAAATTCCATTTGGG + Intergenic
1029630079 7:101744620-101744642 GGCCCACACTAACTCCTTTTTGG + Intergenic
1032052503 7:128657826-128657848 GCCCCACAGAAGCTGCTCCTTGG + Intergenic
1032948732 7:136882627-136882649 AGCTCAAAGAAACTCTTTCTAGG + Intronic
1035008165 7:155685729-155685751 GGCCCACAGCAGCTAGTTCTGGG - Intronic
1036180216 8:6577929-6577951 CCCCCACAGACACTCCATCTCGG - Intronic
1037062000 8:14524632-14524654 AGCACACATATACTCCTTCTTGG + Intronic
1037161676 8:15780733-15780755 TGCCCACACAAACTTCTTCCAGG - Intergenic
1041098564 8:54373578-54373600 GACCCGCACAACCTCCTTCTCGG - Intergenic
1041103460 8:54419110-54419132 GCCCCACAGAAAATCAGTCTTGG + Intergenic
1042067886 8:64899120-64899142 GGCCCACATAGAAACCTTCTGGG - Intergenic
1044066231 8:87703488-87703510 GGCCCACAGAAAGTACTGCCTGG - Intergenic
1045061409 8:98414414-98414436 GACTCACAGAGACACCTTCTGGG - Intronic
1048706134 8:137155687-137155709 GGCCCACAGTAACCACTTCCTGG + Intergenic
1048950323 8:139491501-139491523 CGCACCCAGAATCTCCTTCTTGG - Intergenic
1049744466 8:144257399-144257421 GGCCCCCAGCACCTCCTTCCTGG + Intronic
1053121081 9:35547916-35547938 GGCCCACAGCAGCTGCTGCTTGG - Exonic
1056629181 9:88278520-88278542 GGCTTACAGAAACCCATTCTAGG - Intergenic
1056854630 9:90115674-90115696 GGTCCACAGAAACTCCAGTTCGG - Intergenic
1058547319 9:106074355-106074377 GCCCCCCAGAGAATCCTTCTGGG - Intergenic
1061977781 9:134080319-134080341 GGCTCACTGAAACCTCTTCTAGG + Intergenic
1062264181 9:135679308-135679330 GGCCCACTGAAACCACTTCTGGG + Intergenic
1062755235 9:138283411-138283433 GCCCCACAGAAGCTGCTCCTTGG + Intergenic
1203579146 Un_KI270745v1:27583-27605 GCCCCACAGAAGCTGCTCCTTGG + Intergenic
1186974540 X:14887075-14887097 GATCCACTGAAAGTCCTTCTGGG - Intronic
1188720800 X:33520974-33520996 GGCCCACACAAACTTCTTGCAGG + Intergenic
1189157946 X:38778818-38778840 GGCACACAGAAAGGCTTTCTTGG - Intergenic
1189854373 X:45209201-45209223 GGCCCACAGAAAGTACTGCCAGG + Intergenic
1191194135 X:57703558-57703580 GGCCCATGGTAACTGCTTCTTGG + Intergenic
1191725219 X:64272065-64272087 GGCCCACAGAAGCTCTGGCTTGG + Intronic
1193266106 X:79471710-79471732 GGCCCACAAAAACTCCCTTGTGG - Intergenic
1195998047 X:110750979-110751001 TGCCCACAGAAAGCCGTTCTGGG - Intronic
1196233772 X:113255541-113255563 GGCCCACAGAAATCACTTCCTGG + Intergenic
1198168179 X:134077907-134077929 GGCTAAAAGAAACCCCTTCTTGG + Intergenic
1200089875 X:153629750-153629772 GGCCTACAGACCCTCTTTCTAGG + Intergenic
1201859980 Y:18586271-18586293 GCCTGTCAGAAACTCCTTCTTGG + Intronic
1201873341 Y:18734110-18734132 GCCTGTCAGAAACTCCTTCTTGG - Intronic
1202381760 Y:24280203-24280225 GCCCCACAGAAGCTGCTCCTTGG + Intergenic
1202489025 Y:25389923-25389945 GCCCCACAGAAGCTGCTCCTTGG - Intergenic