ID: 1067567734

View in Genome Browser
Species Human (GRCh38)
Location 10:47350539-47350561
Sequence GCTCACAGCAGACCTCCAGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 391
Summary {0: 1, 1: 0, 2: 2, 3: 43, 4: 345}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067567728_1067567734 17 Left 1067567728 10:47350499-47350521 CCTACCGCACAGCTGTGGACTTG 0: 1
1: 0
2: 0
3: 8
4: 125
Right 1067567734 10:47350539-47350561 GCTCACAGCAGACCTCCAGGAGG 0: 1
1: 0
2: 2
3: 43
4: 345
1067567726_1067567734 25 Left 1067567726 10:47350491-47350513 CCAGGGCGCCTACCGCACAGCTG 0: 1
1: 0
2: 1
3: 6
4: 102
Right 1067567734 10:47350539-47350561 GCTCACAGCAGACCTCCAGGAGG 0: 1
1: 0
2: 2
3: 43
4: 345
1067567725_1067567734 26 Left 1067567725 10:47350490-47350512 CCCAGGGCGCCTACCGCACAGCT 0: 1
1: 0
2: 0
3: 5
4: 77
Right 1067567734 10:47350539-47350561 GCTCACAGCAGACCTCCAGGAGG 0: 1
1: 0
2: 2
3: 43
4: 345
1067567730_1067567734 13 Left 1067567730 10:47350503-47350525 CCGCACAGCTGTGGACTTGGAGT 0: 1
1: 0
2: 1
3: 20
4: 158
Right 1067567734 10:47350539-47350561 GCTCACAGCAGACCTCCAGGAGG 0: 1
1: 0
2: 2
3: 43
4: 345

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067567734 Original CRISPR GCTCACAGCAGACCTCCAGG AGG Exonic
900581480 1:3411940-3411962 CCACACAGGAGTCCTCCAGGCGG - Exonic
900588462 1:3445580-3445602 GCTCACAGCAGACCTGACGCTGG - Intergenic
901158001 1:7153660-7153682 TCTCACAGCAGACAGCCAGTGGG + Intronic
901703452 1:11057667-11057689 GGTCAGGGCAGGCCTCCAGGAGG - Intronic
902797988 1:18811753-18811775 GCTCACACCAGACCCCCTGTCGG + Intergenic
903101820 1:21036277-21036299 GCTCAGAGGAGACCTGCAGTGGG - Intronic
903213074 1:21829392-21829414 ACTCATAGCGGAACTCCAGGTGG + Exonic
904443832 1:30551475-30551497 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
904586098 1:31581471-31581493 GTTCACATCAGAGCTCCAGGTGG - Intronic
905915587 1:41682245-41682267 GCTCAGAGAAGACTTCCTGGTGG - Intronic
905970421 1:42137749-42137771 GCTCCCAACACCCCTCCAGGAGG - Intergenic
906082355 1:43101706-43101728 GCTCACAGGACACCTGCAGGGGG + Intergenic
906738860 1:48161095-48161117 GCTGACAGCAGAACTACACGTGG + Intergenic
907224413 1:52931276-52931298 CCTCCCAGCAGAACTCCAGAAGG + Intronic
907761872 1:57368662-57368684 GCTCAGAGGAGACCTGCAGTGGG - Intronic
908824480 1:68120076-68120098 GCTCACAGCAGATCTGCATCAGG + Intronic
910654903 1:89609655-89609677 GCTCAGAGGAGACCTGCAGTGGG + Intergenic
922575757 1:226659712-226659734 CTGCACAGCAGACCTGCAGGTGG + Intronic
922785257 1:228279428-228279450 GCTCACCTGAGACCACCAGGCGG - Exonic
922785477 1:228280429-228280451 ACTCACCTCGGACCTCCAGGCGG - Exonic
923454122 1:234148154-234148176 TCTTCCTGCAGACCTCCAGGTGG + Intronic
1063029166 10:2214599-2214621 GATACCAGCAGACCACCAGGTGG + Intergenic
1063198613 10:3766176-3766198 GCCCACAGCAGCCCTCCCAGGGG + Intergenic
1064023874 10:11831023-11831045 GCTCACACAAGACCTCCTGGTGG - Intronic
1064289845 10:14023493-14023515 GCTCACAGCCGCCTTCCCGGGGG + Intronic
1065188780 10:23192632-23192654 GCTCATCGCCGTCCTCCAGGGGG - Exonic
1066071624 10:31820440-31820462 GTTCACAGTGGACCTCAAGGGGG - Exonic
1066101501 10:32122287-32122309 GCTCAGAGGAGACCCGCAGGGGG + Intergenic
1066188913 10:33037436-33037458 GCTCTCAGGAGACCTACAGTGGG - Intergenic
1067144712 10:43686675-43686697 GGCCACAGAAGACGTCCAGGTGG + Intergenic
1067567734 10:47350539-47350561 GCTCACAGCAGACCTCCAGGAGG + Exonic
1068161214 10:53267110-53267132 GCTCTCAGAAGACCTTCATGTGG - Intergenic
1069602635 10:69717801-69717823 GCTCAGAGCAGCCATCCTGGGGG - Intergenic
1069757625 10:70782783-70782805 GGTCCCAGCAGGCCTCCAGTGGG - Intronic
1070213480 10:74350561-74350583 GATCACAGCAGAACTGAAGGAGG + Intronic
1070839681 10:79475504-79475526 CCTCGCAGCAGACCTTCTGGAGG - Intergenic
1071000755 10:80828171-80828193 CCTCACAGCAGATCCCTAGGAGG + Intergenic
1072846676 10:98838847-98838869 GCTCTCAGCTGACCTCTAGGAGG + Intronic
1075007884 10:118843499-118843521 GCTCAGAGGAAACCTACAGGGGG - Intergenic
1075023882 10:118969671-118969693 GCTCACAGGAGCCCTCCGGGAGG + Intergenic
1075899262 10:126025943-126025965 ACTAACAGCAGACCTCCCAGTGG + Intronic
1076053230 10:127351755-127351777 GCTGTCACCAGACCTCAAGGGGG - Intronic
1076831225 10:132995301-132995323 CCTCACACCTGACCTCCATGTGG + Intergenic
1076831238 10:132995364-132995386 CCTCACACCTGACCTCCATGTGG + Intergenic
1076831252 10:132995427-132995449 CCTCACACCTGACCTCCATGTGG + Intergenic
1078362920 11:10683555-10683577 GCACACAGCAGAGAACCAGGGGG - Intronic
1078546219 11:12248842-12248864 GCACACAGGAGACCTCCAAAAGG - Intronic
1078836364 11:15034637-15034659 GCTCAGAGGAGACCTACAGTGGG + Intronic
1080403120 11:31955376-31955398 GCACACTGCACACCCCCAGGGGG + Intronic
1082750058 11:57005700-57005722 GTTCACAGCAGACTTGCATGGGG + Intergenic
1084322594 11:68381878-68381900 GCCCACAGCTGGCCTCCAGGAGG - Intronic
1085334182 11:75678597-75678619 GCTCTCAGGAGACCTGCAGTGGG + Intergenic
1085502843 11:77038888-77038910 GCTCACAACAGCCCTGCAGTAGG + Intronic
1086249385 11:84795494-84795516 GCTCAGAGGAGACCTGCAGTGGG - Intronic
1087037847 11:93772704-93772726 GCTCAAAGAAGACCTGCAGTGGG + Intronic
1087311409 11:96548164-96548186 GCTCAGAGCAGAACTGAAGGAGG + Intergenic
1087596138 11:100257163-100257185 GCCCATTGCAGACTTCCAGGTGG - Intronic
1087928884 11:103952549-103952571 GCTCATATCAGACCCCCAGATGG - Intronic
1088135707 11:106553011-106553033 GCTCAGAGGAGACCTGCAGGGGG - Intergenic
1088513347 11:110600021-110600043 GCTCAGAGGAGACCCACAGGGGG - Intronic
1088887188 11:114017008-114017030 GCTCACAGCAGTCAGGCAGGAGG - Intergenic
1089295243 11:117463511-117463533 GCACAAAGCAGACCTCCTGGAGG - Intronic
1089353287 11:117833565-117833587 TGTCACAGCTGAGCTCCAGGGGG - Intronic
1090237803 11:125162498-125162520 GCACACAGCAGAGCTTCTGGTGG + Intergenic
1090910096 11:131111187-131111209 GCTCAGAGGAGACCTGCAGTGGG + Intergenic
1091059552 11:132448743-132448765 GCTAACAGTAGAACTCAAGGAGG + Intronic
1091301285 11:134509757-134509779 GCTCACAGGAGACAGCTAGGAGG - Intergenic
1091647431 12:2284485-2284507 GCACAGAACAGCCCTCCAGGCGG + Intronic
1091948550 12:4571472-4571494 ACTCACAGCACACCCCCAGTAGG - Intronic
1092889373 12:12954472-12954494 GCTGTCAGCAGAACTGCAGGAGG + Intergenic
1093547920 12:20369527-20369549 GGTCACAGCCGACCTCCCCGCGG - Exonic
1095145479 12:38721478-38721500 GCTTACAGGAGACCCTCAGGGGG - Intronic
1096460030 12:51817159-51817181 GCTCACTGCACACATACAGGAGG - Intergenic
1096954919 12:55516426-55516448 GCTCACAGATGCCCTCCTGGGGG + Intergenic
1097129905 12:56804360-56804382 GCTCAGAGGAAACCTGCAGGGGG + Intergenic
1097446451 12:59678373-59678395 GCTCAGAGGAGACCTGCAGTAGG + Intronic
1100672764 12:96834909-96834931 GCTCACAGGAGACCTGCAGCAGG + Intronic
1101002983 12:100374882-100374904 CCTCACAGCAGCTCTCCAGTTGG - Intronic
1101086306 12:101239786-101239808 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
1101292746 12:103388290-103388312 GGTCCCAACAGACCTCCAGATGG + Intronic
1102206669 12:111095652-111095674 TCTCACTGCAGCCCTCAAGGAGG - Intronic
1105401413 13:20099472-20099494 GCTGCCAGCAGAACCCCAGGGGG + Intergenic
1105945335 13:25184846-25184868 GCTTACAGCATAGCTCAAGGAGG + Intergenic
1106587577 13:31070588-31070610 GCTCAGAGCAGACTTCTAGCAGG - Intergenic
1106906919 13:34419048-34419070 GCTCACAGAAATCCTGCAGGAGG + Intergenic
1107566084 13:41606086-41606108 GATCAGAGCAGACTTCCTGGAGG - Intronic
1107935407 13:45341519-45341541 GCTCCCAGCACCTCTCCAGGCGG - Intergenic
1109345840 13:61113699-61113721 GCTCAGTGCAGACCTGAAGGTGG + Intergenic
1109837497 13:67878097-67878119 GCTCAGAGAAGACCTGCAGTGGG - Intergenic
1110778024 13:79432686-79432708 GCTCAGAGGAGACCTTCAGTGGG - Intergenic
1111469585 13:88661076-88661098 ACTAACAGCAGACCTCCCAGTGG - Intergenic
1111772940 13:92622248-92622270 GCTGAGGACAGACCTCCAGGAGG - Intronic
1111935014 13:94549319-94549341 TCTCACACCAGCCCCCCAGGCGG + Intergenic
1112740861 13:102471863-102471885 GCTCAGAGGAGAACTTCAGGGGG + Intergenic
1113004204 13:105680059-105680081 GGTCTGAGCAGACCTCCCGGCGG + Intergenic
1113912087 13:113847202-113847224 GTCCACAGCACACCTGCAGGAGG - Intronic
1114516475 14:23302823-23302845 GCTCAGAGCAGACCGCTAGCAGG - Exonic
1114604406 14:23985118-23985140 GCCCTCAGCAAACCTCCTGGTGG + Intronic
1115000007 14:28410831-28410853 GCCCTCAGCAAACCTCCTGGTGG - Intergenic
1116083361 14:40204326-40204348 GCTGACAGGAGACCTGCAGTGGG + Intergenic
1117899150 14:60515179-60515201 TTTCCCAGCAGGCCTCCAGGGGG - Intronic
1118213491 14:63787576-63787598 GCTCAGAGGAGACCTGCAGTGGG + Intergenic
1118473068 14:66093372-66093394 GCTCACAGGAGACCCGCAGTGGG + Intergenic
1118946968 14:70397915-70397937 GCTCAGAGGGGACCTGCAGGGGG + Intronic
1119123124 14:72098209-72098231 GTTCAAAGAGGACCTCCAGGAGG - Intronic
1120057802 14:79946044-79946066 TATGACAGCAGAGCTCCAGGGGG + Intergenic
1121023396 14:90596594-90596616 GCTCACAGCAGCCTTCCTGTAGG - Intronic
1122275958 14:100590925-100590947 GCTCACAGCACCACCCCAGGAGG - Intergenic
1202840237 14_GL000009v2_random:114595-114617 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
1202909618 14_GL000194v1_random:104792-104814 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
1124579581 15:30941676-30941698 CCCCATAGCAGGCCTCCAGGGGG + Exonic
1124820916 15:33044801-33044823 GCTCAGAGGAGACCTACAGTGGG - Intronic
1126199438 15:45969228-45969250 GCTCCCTCCAGAACTCCAGGTGG + Intergenic
1126386177 15:48095678-48095700 GCTCAGAGCAGACATCAAGCTGG - Intergenic
1126447167 15:48760587-48760609 GCACCAAGCAGTCCTCCAGGAGG - Intronic
1128090283 15:64914626-64914648 GCTCACAGCAGGCCCAAAGGTGG - Intronic
1128708127 15:69852096-69852118 CCTCACAGCAGCCCTGCAAGGGG - Intergenic
1128819043 15:70635684-70635706 CCTGGCAGCAGACCACCAGGAGG - Intergenic
1129320504 15:74772094-74772116 GCTCCCAGCAGCCCACCTGGTGG + Intergenic
1129724788 15:77896264-77896286 GCCCACAGGGGACCTCTAGGGGG - Intergenic
1130069038 15:80630981-80631003 GCTCACTGCAGACCCCCCGCGGG + Intergenic
1132232314 15:100193247-100193269 GCTCCCGGGAGACCTCAAGGAGG - Intronic
1132301538 15:100779169-100779191 GATGACGGCAGACTTCCAGGTGG + Intergenic
1132796857 16:1728795-1728817 GCACACAGCAGCCCCCCAGACGG + Intronic
1132951144 16:2563126-2563148 GCTGCCAGCAGAGCTCCAGGAGG + Intronic
1132963206 16:2637044-2637066 GCTGCCAGCAGAGCTCCAGGAGG - Intergenic
1133346182 16:5072041-5072063 ACTCACTGCAGAACCCCAGGAGG - Exonic
1133907203 16:10033190-10033212 GCTCACTGCAGAGTTCCATGTGG - Intronic
1134886451 16:17797451-17797473 GCTGCCAGCAGAACTCCCGGTGG + Intergenic
1136113635 16:28080666-28080688 CCTCACAGCTGCCTTCCAGGTGG - Intergenic
1136417463 16:30112750-30112772 GCTGACAGTCGAGCTCCAGGAGG + Exonic
1137256464 16:46778893-46778915 GCTCAGAGGAGACCTGCAGGGGG - Intronic
1137382555 16:48012690-48012712 GCTCACAGCAGATTTCCATCTGG + Intergenic
1137825225 16:51489220-51489242 GCTCAGAGGAGACCTGCAGTGGG + Intergenic
1138027940 16:53537545-53537567 GCTCATAGCAGACACCCTGGGGG + Intergenic
1138082198 16:54101038-54101060 GCTCAGATCGTACCTCCAGGAGG - Intronic
1139312578 16:66040009-66040031 GCTCACCCCAGACCTCATGGTGG + Intergenic
1139489813 16:67280100-67280122 GCACACAGCAAATCTCCAGTCGG - Exonic
1139974155 16:70795686-70795708 GCTCCCAGCAGCCCTCCCTGGGG + Intronic
1140195262 16:72849810-72849832 GCTCTCAGCTGACTTCCAGGTGG + Intronic
1140727365 16:77825522-77825544 GCTCACATAAGACCTCAGGGGGG - Intronic
1141149534 16:81554498-81554520 GTTCACAACACACCTCCAGGAGG + Intronic
1141993487 16:87623002-87623024 GCCCACAGCCGACCTCCACCAGG - Intronic
1142024357 16:87804562-87804584 CCCCACAGCAGAGCTCCAGTGGG - Intergenic
1142388828 16:89784748-89784770 GCTCAGAGCAGATCTGCAGGAGG + Intronic
1142432939 16:90040332-90040354 GTTCACCGCAGCCATCCAGGAGG + Exonic
1143974037 17:10816844-10816866 TCTCACACTAGACATCCAGGTGG - Intergenic
1147588450 17:41666297-41666319 TCTCTTAGCAGGCCTCCAGGTGG + Intergenic
1148342390 17:46881091-46881113 TCTCCCATCAGACCCCCAGGAGG - Intronic
1148463016 17:47848840-47848862 GCTGACAGCAGGTCTGCAGGGGG - Intronic
1149340706 17:55683152-55683174 GCTCAGGGCAGATCTTCAGGAGG + Intergenic
1149482871 17:57017743-57017765 GCTCAGAGGAGACCTGCAGTGGG + Intergenic
1150613017 17:66748922-66748944 GCACACAGGAGACCTCACGGTGG + Intronic
1151141051 17:71992728-71992750 ACTCTCAGCAGATCTTCAGGAGG + Intergenic
1151475686 17:74343251-74343273 GCTCACAGTAGGCATGCAGGAGG - Intronic
1151758592 17:76088373-76088395 TCTCAGAGCAGGCCTCCAAGAGG - Intronic
1152705087 17:81839244-81839266 GCTCCCAGCTCACCTCCAGCAGG - Intergenic
1153139307 18:1954179-1954201 GCTCAGAGGAGACCTGCAGTGGG + Intergenic
1155027860 18:21958501-21958523 ACTCACAGCAGACCCGCAGTGGG + Intergenic
1155120631 18:22815963-22815985 GCTCAGAGGAGACCTGCAGTGGG + Intronic
1155837049 18:30598911-30598933 GCTCACATCAGGTCTCCAGAAGG + Intergenic
1156160409 18:34351535-34351557 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
1158198015 18:54910087-54910109 GCTCAGAGGAAACCTGCAGGGGG + Intronic
1158851275 18:61497523-61497545 ACTCCCTACAGACCTCCAGGAGG - Intronic
1159632584 18:70766066-70766088 GCTCAGAGCAGAACTGAAGGAGG - Intergenic
1159930578 18:74309216-74309238 GCTCCCAGCAGACATGCTGGTGG - Intergenic
1160040785 18:75343679-75343701 GGTCACAGCAGTTGTCCAGGGGG + Intergenic
1160374675 18:78402420-78402442 GCTCACAGGCCACCCCCAGGAGG + Intergenic
1162142465 19:8592855-8592877 GCTCGCTGCAGACCTCCTGCGGG + Exonic
1162385378 19:10357799-10357821 CGTCAAAGCAGATCTCCAGGAGG + Exonic
1162930566 19:13955585-13955607 GGTAACAGCACACCTCCTGGGGG - Intronic
1163642772 19:18470826-18470848 GCTGGCTGCAGACCTCCAGTAGG - Intronic
1164753676 19:30674087-30674109 GCTCACATCACATCTCCAAGAGG + Intronic
1164983738 19:32632915-32632937 CCTCCCAGCAGTCCCCCAGGAGG + Intronic
1165439511 19:35816593-35816615 GCTCAAGGCAGACCTCCTTGAGG - Intergenic
1167206066 19:48103246-48103268 GCACATTGCAGAACTCCAGGGGG - Intronic
1167235115 19:48309513-48309535 GCTCAGAGGAGACCTGCAGGGGG - Intronic
1167379520 19:49130419-49130441 GCGCACAGCAGAGCTGGAGGAGG + Exonic
1167526940 19:49990097-49990119 CCTCACACCAGACCTCCTGTTGG + Intronic
1167620269 19:50556503-50556525 GCTCAAAGAAGACCTCCTGGAGG - Intronic
1167857900 19:52257379-52257401 GCCCTCAGCAAACCTCCTGGTGG + Intergenic
1168129900 19:54311547-54311569 ACTCACAGCTGACCCCCAGTGGG - Exonic
1168238195 19:55076400-55076422 GCTCCCAGGGCACCTCCAGGTGG + Exonic
1202659093 1_KI270708v1_random:51658-51680 GCTCAGAGGAGACCTGCAGTGGG + Intergenic
924963932 2:58315-58337 GCTCAGAGGAGACCCACAGGTGG - Intergenic
926707365 2:15846222-15846244 GCTCAGAGCTGGCCTCCAGGAGG + Intergenic
926730388 2:16031634-16031656 GCTGTCAGGAGACCTCCTGGTGG - Intergenic
926934719 2:18075509-18075531 GCTCAAAGCAGAACCCCAAGAGG + Intronic
927000396 2:18788771-18788793 GGTCACAGCAGAATTCCAGGAGG + Intergenic
927513564 2:23659199-23659221 GCACACTGCACAACTCCAGGGGG - Intronic
927970844 2:27305739-27305761 GCTTAGAGGAGGCCTCCAGGTGG - Exonic
927997146 2:27494565-27494587 GGTCACAGCTGACCAGCAGGAGG + Exonic
929014619 2:37481971-37481993 GCTCAGAGCAGACCTCCATTGGG - Intergenic
932440734 2:71733091-71733113 GCTCACAGTGGACCTCCCGCTGG + Intergenic
933157995 2:78995003-78995025 GCTCACAGCAGTGGTCTAGGAGG - Intergenic
937009428 2:118548951-118548973 TCTCAGAGAAGACCTCCATGTGG - Intergenic
937163981 2:119794893-119794915 GCTCAGAGGAGACCTGCAGTGGG + Intronic
937279051 2:120704943-120704965 GCACAGAGCAGACCTACAAGGGG - Intergenic
937279169 2:120705580-120705602 GCTCAAAGCAGCCCTGCAAGAGG - Intergenic
938129149 2:128695746-128695768 GCTCTCAGGCCACCTCCAGGTGG - Intergenic
938608475 2:132921594-132921616 GCTCAGAGAAGGCCTCCTGGAGG + Intronic
938654844 2:133420734-133420756 CCTCACAGCAAACCGCCAGGAGG + Intronic
942759610 2:179382952-179382974 TCCCACAGCAGATCTCAAGGGGG + Intergenic
943734540 2:191339933-191339955 TCTCACAGGAGACCTGCAGGTGG - Intronic
944483877 2:200182834-200182856 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
946194200 2:218023372-218023394 GCTCACAGCAGCCCTGAAGGGGG - Intergenic
946412209 2:219521083-219521105 GCTGACAGCACCCCTCCAGGAGG - Intronic
947435382 2:230068291-230068313 GTTCAGGGCAGACCGCCAGGCGG - Intronic
948572140 2:238924443-238924465 GCTCACAACAGTGCCCCAGGCGG + Intergenic
948713046 2:239837090-239837112 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
948902605 2:240964031-240964053 GGTCACAGGTGGCCTCCAGGAGG + Intronic
948991035 2:241554137-241554159 GGCCACAGCAGCCTTCCAGGAGG + Intergenic
1168896972 20:1330542-1330564 ACTCACACCATTCCTCCAGGTGG + Intronic
1168905097 20:1396925-1396947 GCCCTCAGCAAACCTCCTGGCGG - Intergenic
1169274765 20:4226214-4226236 GCTCACAGCAGACTTCAGGTTGG - Intronic
1170046106 20:12087152-12087174 GCCCACAGCTTACATCCAGGTGG + Intergenic
1171201254 20:23244261-23244283 GCCCACAGCAGAGCTGCAGGCGG + Intergenic
1173027982 20:39326954-39326976 TCTCCCAGGAGAGCTCCAGGAGG - Intergenic
1173081999 20:39877399-39877421 GCTCCCTGCAGGCCTCCAGGGGG - Intergenic
1174504726 20:51009840-51009862 GCTTGCAGCAGCCGTCCAGGTGG + Exonic
1175065146 20:56277791-56277813 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
1175777864 20:61664244-61664266 GGTGACAGCACAGCTCCAGGAGG - Intronic
1175798731 20:61788614-61788636 GCTGACAGCAGTCCTGCAGGAGG + Intronic
1176180601 20:63747686-63747708 CCACACAGCAGAACTGCAGGTGG + Intronic
1176628968 21:9119500-9119522 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
1178887106 21:36493182-36493204 CCTCACAGCTGCTCTCCAGGAGG - Intronic
1179442167 21:41402938-41402960 GCTCACTGCACACCTCCTGCCGG + Intronic
1179490368 21:41737213-41737235 GCTCACTGCAGCCCTCCCAGTGG - Intergenic
1180178869 21:46108955-46108977 GCTCACAGGAGACCCGCAGGGGG + Intronic
1180378171 22:12113944-12113966 GCTCAGAGGAGACCTGCAGTGGG + Intergenic
1181804032 22:25364499-25364521 GCCCACAGCTGGCCTCCAGGAGG + Intronic
1182452990 22:30432360-30432382 TCTTCCTGCAGACCTCCAGGTGG - Intergenic
1182713050 22:32334523-32334545 GCTCACAGCAGCCAACCAGCAGG - Intergenic
1182866458 22:33608409-33608431 GCTCAAAGAAGATTTCCAGGAGG - Intronic
1183007950 22:34918915-34918937 GCTCACAACAGACATCCTGAAGG - Intergenic
1183732424 22:39626111-39626133 GCACAGAGCAAACCTCCAGCTGG - Intronic
1184339305 22:43877278-43877300 GCTCACAGGAGGCCCCCAGTGGG + Intergenic
1184514557 22:44954025-44954047 GCTCAGAGCAGACCCCCAGTGGG + Intronic
1184596773 22:45518695-45518717 CCGCACAGCAGGCCTCCAGGAGG - Exonic
1184665743 22:45988036-45988058 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
1184865786 22:47201298-47201320 GCTCAGAGAAGACCCACAGGGGG + Intergenic
1185014725 22:48336208-48336230 GCACACAGGAGACCCCCTGGTGG - Intergenic
1185070319 22:48652466-48652488 GCTCACAGGAGACCGCCTGCTGG + Intronic
1185133770 22:49056777-49056799 GCCCACAGCAGCCCCCCTGGAGG - Intergenic
949226414 3:1700369-1700391 GCTCTCAGGAGACCTGCAGTGGG - Intergenic
950704629 3:14772236-14772258 GCTCACAGCAGGCCACCTCGGGG + Intronic
950906605 3:16544600-16544622 TTTCACAGCAGCCCCCCAGGGGG - Intergenic
951967051 3:28398825-28398847 CCTCACAGGAGTCCTTCAGGAGG + Intronic
953578716 3:44134363-44134385 TCTCAGAGCAGAGCTCCAGCAGG + Intergenic
954238907 3:49277923-49277945 GCTCAGGGCAGCCCTGCAGGTGG + Intronic
954644579 3:52123122-52123144 GCTCACAGGAGACAGCCTGGTGG + Intronic
954647599 3:52141018-52141040 GCTCACAGCTGCCACCCAGGTGG - Intronic
955814090 3:62823548-62823570 GCTAACAGCAGACTTCAAAGAGG + Intronic
957095295 3:75772203-75772225 GCTCAGAGGAGACCTGCAGGGGG - Intronic
958013726 3:87914235-87914257 TCTCAGAGAAGACCTTCAGGAGG + Intergenic
958448968 3:94249689-94249711 ACACAGAGCAGACCACCAGGGGG + Intergenic
959260119 3:104067660-104067682 CCCCACAGCACACATCCAGGAGG - Intergenic
959863617 3:111242561-111242583 GCTCACAGGAGACCTGCAGGAGG + Intronic
960333907 3:116392995-116393017 GCTCAGAGGAGACCCCCAGTGGG - Intronic
961219246 3:125186998-125187020 GGTCACATCAGGCATCCAGGAGG + Intronic
961942925 3:130656344-130656366 GCTCAGAGGAGACCTGCAGTGGG + Intronic
963805205 3:149715042-149715064 GCTCAGAGGAGACCTGCAGTGGG - Intronic
965005684 3:163019513-163019535 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
965309851 3:167115281-167115303 GCTCAGAGGAAACCTGCAGGGGG + Intergenic
967816948 3:193807605-193807627 ACACAGAGCAGACATCCAGGAGG + Intergenic
968707127 4:2084564-2084586 TCTCACAGCAGACGGGCAGGTGG - Intronic
968904544 4:3445334-3445356 GCGCACCGCAGGCCTCCAGGCGG - Exonic
969433419 4:7169382-7169404 GGTCACGGCAGACTTCCCGGAGG + Intergenic
969620803 4:8277846-8277868 GCTCACAGCTGACCACTGGGTGG + Intronic
969697713 4:8744548-8744570 GCTCACTGCACTCCACCAGGCGG + Intergenic
971092463 4:23361153-23361175 GCTCTCAGGAGACCTGCAGTGGG - Intergenic
971478131 4:27091079-27091101 GCCCACAGGAGACCACCAGTGGG - Intergenic
971714041 4:30153055-30153077 GCTCAGAGGAGACCTACAGTGGG + Intergenic
972072612 4:35039278-35039300 GCTCAGAGGAGACCTGCAGTTGG - Intergenic
972630363 4:40836724-40836746 GGTCACTGCAGACCTCCCTGTGG - Intronic
974278439 4:59758899-59758921 GCTCAGAGAAGACCTGCAGTGGG + Intergenic
974400885 4:61404308-61404330 GTTCAGAGCAGACCTCCCTGAGG + Intronic
974683448 4:65194638-65194660 GCTCACAGGGGACCTACAGTGGG + Intergenic
974894910 4:67927044-67927066 GCTCACAGGAGACCCACAGTGGG - Intronic
975321373 4:73012419-73012441 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
975913716 4:79298172-79298194 GCTCAGGGGAGACCTGCAGGGGG - Intronic
976097780 4:81527814-81527836 GCTCAGAGGAGACCTGCAGTGGG + Intronic
976679876 4:87745147-87745169 GCTCAGAGGAGACCTGCAGTGGG + Intergenic
978193415 4:105942621-105942643 GCTGCCAGTACACCTCCAGGAGG + Exonic
979007558 4:115321010-115321032 GCTGTCAGCAGACCTACTGGAGG + Intergenic
979462910 4:121003775-121003797 GCTCAGAGGAGACCCACAGGGGG - Intergenic
980196547 4:129596212-129596234 GTTCTCAGTAGAGCTCCAGGAGG - Intergenic
983491965 4:168399035-168399057 GCTCAGAGGAGACCTGCAGTGGG - Intronic
983784607 4:171715768-171715790 GCTCAGAGGAGGCCTGCAGGGGG - Intergenic
983877763 4:172896874-172896896 TCCCACAGCAGATCTCTAGGAGG - Intronic
985214312 4:187634318-187634340 TCTGACAGCAGAGCTCCAGGTGG - Intergenic
1202759788 4_GL000008v2_random:99409-99431 GCTCAGAGGAGACCTGCAGTGGG + Intergenic
986359158 5:6959115-6959137 GCTAAAAGCTGACCACCAGGTGG + Intergenic
988093176 5:26568925-26568947 GCTCAGAGAAGACCTACAGGGGG + Intergenic
988719286 5:33859747-33859769 TCATACAGCAGAGCTCCAGGTGG + Intronic
989339203 5:40354912-40354934 GCTCAGAGGAGACCTGCAGTAGG - Intergenic
992140568 5:73792928-73792950 TCCCACAGAAGGCCTCCAGGTGG - Intronic
992947193 5:81822326-81822348 CCTCACTGCAGACCTCCCAGGGG - Intergenic
997372740 5:133372350-133372372 ACACACAGGTGACCTCCAGGGGG - Intronic
997610082 5:135209733-135209755 GCCCACAGCAGACCTTGAGAAGG + Intronic
997743467 5:136278253-136278275 GACCACAGGAGCCCTCCAGGAGG - Intronic
997960493 5:138316850-138316872 GCTCAGAGGAGACCCACAGGGGG - Intronic
998148832 5:139745737-139745759 GAACACAGGAGACCCCCAGGCGG - Intergenic
999133243 5:149300296-149300318 GAACACAGCAGACCTCCACTCGG + Exonic
999281900 5:150371613-150371635 GATCACAGCAGCCCTCCTGAGGG - Intronic
999474230 5:151883720-151883742 ACTCACAGCAGGCCACAAGGTGG + Intronic
1001544592 5:172563227-172563249 GCTCATAGCAGACCTGCAGAGGG - Intergenic
1002072372 5:176687902-176687924 ACTCACAGGAGACCTACAGGGGG + Intergenic
1002163837 5:177332675-177332697 GCTCTCGGCAGCCCCCCAGGAGG + Intronic
1003366211 6:5477307-5477329 GCTCACAACAGACCTCCTTCAGG + Intronic
1003571733 6:7260691-7260713 GTCCACTGCAGACATCCAGGTGG + Intergenic
1004333560 6:14743347-14743369 GGTCCCAGCAGGCCTCCAGATGG + Intergenic
1004392807 6:15223541-15223563 GCTCACAGCAGACGGATAGGAGG - Intergenic
1004790683 6:19022877-19022899 GCTCAGAGATGACCTTCAGGAGG - Intergenic
1004868008 6:19873186-19873208 CCACACTGCAGAACTCCAGGGGG + Intergenic
1005453099 6:25992724-25992746 GCTCACACCAGGCCTGCGGGAGG - Intergenic
1005668969 6:28085687-28085709 ACTGACAGCAGAGCTCCCGGAGG - Exonic
1006742450 6:36319284-36319306 GCTCACAGCTGGCCTCCAGTGGG - Intronic
1007529155 6:42525588-42525610 GCGCACTGCACAACTCCAGGAGG - Intergenic
1009798438 6:68502481-68502503 CCTCACAGGGGTCCTCCAGGAGG + Intergenic
1009846855 6:69145680-69145702 GCTCAGAGGAGACCTTCAGTGGG + Intronic
1013709381 6:112879798-112879820 GCTCAGAGGAGACCCGCAGGGGG + Intergenic
1014270431 6:119330228-119330250 GCTCACAAGAGACCTCCAATTGG + Intronic
1016447309 6:144147299-144147321 GCTCACCACTGACCTCCATGTGG + Intergenic
1018652339 6:166002800-166002822 GCTCAGGGCAGAGCTCCTGGTGG + Intergenic
1020586829 7:10079345-10079367 GCTCAGAGGAGACCTGCAGATGG - Intergenic
1020761297 7:12270304-12270326 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
1020879993 7:13749314-13749336 GGTCACAGCAGTCCTTCTGGAGG + Intergenic
1023296252 7:38717798-38717820 GCTCAGAGCAGAGCTCCAGGGGG + Intergenic
1026391989 7:69911583-69911605 GCTCCCAGGAGACCTCAAGTGGG + Intronic
1027162646 7:75813745-75813767 GCTCAAAGCTGACGTGCAGGAGG + Exonic
1027779795 7:82507325-82507347 GCTCAGAGAAGACCTGCTGGAGG + Intergenic
1028144599 7:87307542-87307564 GATCAGAGCAGACCTGAAGGAGG + Intergenic
1028816833 7:95156585-95156607 GCACACAGGAGACCTGCAGAGGG + Intronic
1031242024 7:119257964-119257986 GCTCAGAGGAGACCTGCAGGTGG + Intergenic
1031265339 7:119573169-119573191 GCTCAGAGAAGACCTGCAGTGGG - Intergenic
1034450976 7:151137177-151137199 TCTCACACCAGCCCTGCAGGCGG - Intronic
1035071707 7:156149540-156149562 GCTCACAGCATGTCTCCAGGTGG - Intergenic
1039365513 8:36924312-36924334 TCTCACTGTGGACCTCCAGGAGG - Intronic
1040661900 8:49583626-49583648 GCTCAGAGAAGACCTTCAGTGGG - Intergenic
1040853891 8:51928976-51928998 GCCCCCACCAGACCACCAGGTGG - Intergenic
1041105898 8:54443805-54443827 GCTCACAGCAGATATGCAGTGGG + Intergenic
1041207041 8:55510222-55510244 GATCCCAGGAGTCCTCCAGGTGG + Intronic
1043168747 8:76937166-76937188 GAGAACAGCAGACGTCCAGGAGG - Intergenic
1043174693 8:77010260-77010282 GGTCACTGCAGTCTTCCAGGTGG - Intergenic
1044008637 8:86965802-86965824 GCTCAGAGGAGACCTGCAGCAGG + Intronic
1044409614 8:91868640-91868662 GCTCAGAGGAGACCCACAGGAGG - Intergenic
1045508701 8:102796716-102796738 GCTCACTGCAACCCCCCAGGAGG - Intergenic
1048886446 8:138913718-138913740 GCTGACAGGTGACCCCCAGGAGG - Exonic
1049426512 8:142540318-142540340 GTTCACAGGAGACCCCAAGGGGG - Intronic
1049617603 8:143582469-143582491 AATCACAGCAGACCTCCCGCGGG + Intronic
1049757142 8:144315744-144315766 GCTCTCAGCTGCCCTCCACGAGG - Exonic
1049824069 8:144655640-144655662 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
1049826262 8:144670699-144670721 GCTCAGGGCAAGCCTCCAGGAGG - Intergenic
1049836514 8:144738962-144738984 GCACACAGCAGCCCTCCCAGGGG + Intronic
1050942009 9:11471894-11471916 GCTGAGAGGAGACCACCAGGGGG - Intergenic
1051406782 9:16746164-16746186 GCTCAAAGCAGTCACCCAGGAGG + Intronic
1053228518 9:36384314-36384336 GTTTACAGAACACCTCCAGGCGG - Intronic
1053427363 9:38019305-38019327 GGTCAGAGCAGGTCTCCAGGAGG - Intronic
1055645495 9:78357981-78358003 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
1057624680 9:96666778-96666800 GCTCACACCTGACCACAAGGAGG - Intergenic
1058745073 9:107982403-107982425 GCTTACAGAAGTCCACCAGGTGG + Intergenic
1059524412 9:114977051-114977073 ACTCAAACCAGACCTCCAGATGG - Intergenic
1060408899 9:123386965-123386987 GCCCACAGCAACCTTCCAGGGGG - Intronic
1061119927 9:128636123-128636145 GCTCACTGCAGACCTTCACCTGG + Intronic
1061149592 9:128821233-128821255 GTGCACCGCAGACCTGCAGGGGG - Exonic
1061847248 9:133394654-133394676 CCTCGCAGCAGCCCTCCAGGTGG + Intronic
1203691579 Un_GL000214v1:47624-47646 GCTCAGAGGAGACCTGCAGTCGG + Intergenic
1203751813 Un_GL000218v1:87181-87203 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
1203540564 Un_KI270743v1:84304-84326 GCTCAGAGGAGACCTGCAGTGGG + Intergenic
1203644716 Un_KI270751v1:56567-56589 GCTCAGAGGAGACCTGCAGTCGG - Intergenic
1188350696 X:29127622-29127644 GCCTACAGCACACCTCCACGTGG + Intronic
1188859395 X:35239025-35239047 GCACACAGCAGACATTCAAGTGG - Intergenic
1189401334 X:40671612-40671634 ACTCACAGCACAACTCCAGGGGG - Intronic
1189912452 X:45824736-45824758 GCTCACAGCCCACCACAAGGCGG + Intergenic
1193217247 X:78878018-78878040 GCTCAGAGCAGAACTGAAGGAGG + Intergenic
1193468690 X:81875016-81875038 GCTCAGAGAAGACCTGCAGTGGG + Intergenic
1194379411 X:93175564-93175586 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
1195655079 X:107325226-107325248 GCTCAGAGAAGACCTGCAGGGGG - Intergenic
1197378458 X:125710216-125710238 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
1197421324 X:126238828-126238850 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
1199187946 X:144939064-144939086 GCTCAGAGGAGACCTACAGTGGG + Intergenic
1199861072 X:151800989-151801011 GCTCAGAGGAGACCCGCAGGGGG + Intergenic
1200076452 X:153553680-153553702 GCTCACAGCAAAGGTCCTGGCGG + Intronic
1200081971 X:153581708-153581730 TGTCACAGCAGACATCAAGGTGG - Exonic
1200094655 X:153651614-153651636 GCTCACAGCAGACTTTCTAGTGG + Intergenic
1200424827 Y:3009221-3009243 GCTCTCAGGAGACCTGCAGTGGG + Intergenic
1201165467 Y:11204801-11204823 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
1202018145 Y:20434213-20434235 GCTCAGAGAAGACCTGCAGTTGG + Intergenic
1202349693 Y:23974691-23974713 GCTCAGAGCAGACATTCAGCAGG - Intergenic
1202521086 Y:25695429-25695451 GCTCAGAGCAGACATTCAGCAGG + Intergenic