ID: 1067568452

View in Genome Browser
Species Human (GRCh38)
Location 10:47354488-47354510
Sequence CACACACAGAACTGGAGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 385
Summary {0: 1, 1: 0, 2: 4, 3: 42, 4: 338}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067568452_1067568455 -3 Left 1067568452 10:47354488-47354510 CCCTGGCTCCAGTTCTGTGTGTG 0: 1
1: 0
2: 4
3: 42
4: 338
Right 1067568455 10:47354508-47354530 GTGTTCACAGCCTGAGCTTGAGG No data
1067568452_1067568458 6 Left 1067568452 10:47354488-47354510 CCCTGGCTCCAGTTCTGTGTGTG 0: 1
1: 0
2: 4
3: 42
4: 338
Right 1067568458 10:47354517-47354539 GCCTGAGCTTGAGGCTCCTGGGG No data
1067568452_1067568457 5 Left 1067568452 10:47354488-47354510 CCCTGGCTCCAGTTCTGTGTGTG 0: 1
1: 0
2: 4
3: 42
4: 338
Right 1067568457 10:47354516-47354538 AGCCTGAGCTTGAGGCTCCTGGG No data
1067568452_1067568456 4 Left 1067568452 10:47354488-47354510 CCCTGGCTCCAGTTCTGTGTGTG 0: 1
1: 0
2: 4
3: 42
4: 338
Right 1067568456 10:47354515-47354537 CAGCCTGAGCTTGAGGCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067568452 Original CRISPR CACACACAGAACTGGAGCCA GGG (reversed) Intronic
900122069 1:1052843-1052865 CACACACATACATGGACCCATGG - Intronic
900147614 1:1165294-1165316 CCCACCCAGCCCTGGAGCCAGGG + Intergenic
900317201 1:2063251-2063273 TACACCCAGAACTGAAGGCAGGG - Intronic
900352932 1:2245411-2245433 TACACCCAGAACTGAAGGCAGGG - Intronic
900690233 1:3976434-3976456 CTCACACAGAGCAAGAGCCAAGG - Intergenic
900949431 1:5849617-5849639 GACACACAGGAATGGATCCAAGG + Intergenic
901482032 1:9531819-9531841 CACACACACACCTGGAGGCTGGG - Intergenic
902222251 1:14974036-14974058 CACTCACATATCTGGTGCCATGG + Intronic
902768866 1:18634208-18634230 AACAAACAAAACTGGAGTCAGGG + Intronic
902941041 1:19800164-19800186 CACACACAGATGTGGCGCCGCGG - Intergenic
903029695 1:20454915-20454937 CACAGACAGGACTGGGGCCCTGG - Intergenic
904187143 1:28714335-28714357 CAGTCACAGGACTGGAGCCCTGG - Exonic
904385684 1:30140593-30140615 CTCACACAGGCCTGGAGCCTGGG + Intergenic
904524547 1:31122924-31122946 CACACACAGCACTGGCTCCAGGG - Intergenic
905072309 1:35237470-35237492 AACAAACAAAACTGGAGGCAGGG + Intergenic
905279113 1:36837604-36837626 AACCCACTGAAGTGGAGCCAGGG - Intronic
905463013 1:38133675-38133697 CGCTCCCAGAGCTGGAGCCAGGG - Intergenic
906155018 1:43608979-43609001 CACAAACAGCACAGGAGACAGGG - Intronic
908962688 1:69718515-69718537 AAAACACAGAACTGGAGCTCTGG + Intronic
909718126 1:78735088-78735110 CACACACACAATTTGAGTCAGGG + Intergenic
909808826 1:79905852-79905874 CCAACACAGAACTTGGGCCATGG - Intergenic
910832004 1:91470709-91470731 CACACAGAGCACTAGAGCCATGG + Intergenic
911548271 1:99247449-99247471 CACATACAAAACTGGAGACAGGG + Intergenic
911775364 1:101804429-101804451 CTCCCACTTAACTGGAGCCAAGG - Exonic
913282790 1:117201640-117201662 CACCCACAGAGCTGGCCCCAAGG + Intronic
916400504 1:164442867-164442889 CAGAAAAAGAACTGGAGACAGGG - Intergenic
917225886 1:172781896-172781918 CTCACTCAGAACAAGAGCCATGG - Intergenic
917547304 1:175984299-175984321 CCAACAGAGAACTCGAGCCATGG + Intronic
917846544 1:179025496-179025518 CACAAACAGAACTCGACCTAGGG + Intergenic
920196080 1:204228242-204228264 GACACACAGAAATGGAGGGAGGG + Intronic
920891198 1:209987010-209987032 CACACTGGGAACTGGAGCAAAGG - Intronic
922571452 1:226636738-226636760 CACACACAGAGCTGCAGTCCTGG - Intronic
922869218 1:228886760-228886782 CACACACAGAAAAAGAGCCAGGG - Intergenic
924403631 1:243718250-243718272 CATACACACAACTGGGGACATGG + Intronic
1062839639 10:660222-660244 CATACACAGAACTTGAAACAGGG - Intronic
1062839653 10:660357-660379 CATACACAGAACTTGAAACAGGG - Intronic
1063012789 10:2041603-2041625 AACCCACAGAACCTGAGCCATGG - Intergenic
1063046019 10:2393111-2393133 CCCACACAGAAGGGGAGCCAAGG - Intergenic
1063421699 10:5917321-5917343 CCCATACAGCAGTGGAGCCAGGG - Intronic
1067568452 10:47354488-47354510 CACACACAGAACTGGAGCCAGGG - Intronic
1068789648 10:61013485-61013507 CACACAGTGAACTGTAGCCAAGG - Intergenic
1069709759 10:70480668-70480690 CACTCCCAGAACTGCACCCAAGG - Intronic
1070641909 10:78176515-78176537 CAAACACAGACCTGGAGCCAAGG + Intergenic
1071178426 10:82954788-82954810 CACACACACAACTTGTGCCAGGG - Intronic
1071474063 10:86010012-86010034 CAGACACAGAATAGGATCCAGGG + Intronic
1075099263 10:119494443-119494465 TTCACACACAGCTGGAGCCAGGG - Intergenic
1076288627 10:129326316-129326338 CACAGTCAGAGCTGGAGCCAGGG - Intergenic
1076769489 10:132655275-132655297 CACCCACAGCACTGGAGACAGGG + Intronic
1076786708 10:132753297-132753319 AACACACAGCACCGCAGCCATGG + Intronic
1077025068 11:436434-436456 CACACACACACCAGGAGCTACGG + Intronic
1077045944 11:545186-545208 CTCACTCAGAGCTGGGGCCAGGG + Intronic
1078245309 11:9569093-9569115 CACACACTGTACTGGAGAGATGG - Intergenic
1078663386 11:13304869-13304891 CACACAAAGAACAGAAGGCAAGG - Intronic
1078663647 11:13306849-13306871 CACACAAAGAACAGAAGGCAAGG - Intronic
1079498687 11:21076378-21076400 CACACACAGTGGTGGAGGCAAGG + Intronic
1080063422 11:27981640-27981662 CGAACAATGAACTGGAGCCAGGG - Intergenic
1080261857 11:30358116-30358138 CATATGCAGACCTGGAGCCAAGG - Intergenic
1080790213 11:35515711-35515733 AACACAGAGAAATGAAGCCATGG + Intronic
1081474505 11:43413019-43413041 CACACACACAAATGGGGGCAGGG + Intronic
1084310559 11:68313757-68313779 CACAAACAGAACAGGAGCCGCGG - Intronic
1084674028 11:70624004-70624026 GCCACCAAGAACTGGAGCCATGG + Intronic
1085176228 11:74490864-74490886 CAGAGCCAGAACTGGAACCAGGG + Intergenic
1085198330 11:74685498-74685520 GTCACACAGTACTGGAGTCAGGG - Intergenic
1085224610 11:74908131-74908153 CACACACACAACTAGAGGAAGGG + Intronic
1085564187 11:77498487-77498509 CACACACACACATGGTGCCACGG + Intergenic
1085654555 11:78301195-78301217 CACACACATAATGGGAGCAAGGG + Intronic
1088833864 11:113560794-113560816 CACACACAGAAGTGTGACCATGG - Intergenic
1089522315 11:119073383-119073405 CACAGACCAAACTGGAGGCAAGG + Exonic
1090156678 11:124445484-124445506 CACACACAGGACTGGAAGAAGGG - Intergenic
1090558835 11:127906930-127906952 CACACACAGTTCTGGAGGCTGGG + Intergenic
1090749464 11:129733189-129733211 CACTCAGAGAACTGGAGACCAGG - Intergenic
1090945278 11:131424321-131424343 CTCACACTGCACTGGAGACAGGG + Intronic
1093201053 12:16186506-16186528 CACACACAGGACTTGAACCTTGG - Intergenic
1094435234 12:30413732-30413754 CACACAAACAACAGGAGGCAGGG + Intergenic
1094785792 12:33846874-33846896 CCAACACAGAACTGAAGTCATGG - Intergenic
1096869032 12:54582001-54582023 CAGACACAGAAGTGGAGTCAAGG - Exonic
1097939885 12:65292631-65292653 TACAGACAGAACTAAAGCCATGG - Intronic
1097939915 12:65292917-65292939 TACAGACAGAACTAAAGCCATGG + Intronic
1100480462 12:94973002-94973024 CAGCCACAGAACTGCAGCCCGGG + Intronic
1100913227 12:99389049-99389071 CACACAAAGGCCTGGAGACAGGG + Intronic
1101755590 12:107618503-107618525 CACACACACAAGGGGACCCAGGG + Intronic
1101999263 12:109546435-109546457 CACAAGCAGAATGGGAGCCAGGG + Intergenic
1102010740 12:109616924-109616946 CCCACAAGGAGCTGGAGCCATGG + Intergenic
1103237985 12:119389939-119389961 CACACACTGACCAGGAGTCAGGG - Intronic
1103481650 12:121253923-121253945 CACACACAGAACTCGGGGCTTGG + Intronic
1104311330 12:127656509-127656531 CACACACAGCACAGAAGCCTGGG - Intergenic
1104356919 12:128095087-128095109 CAAAAACAGAATTGGAACCAAGG - Intergenic
1104384657 12:128339748-128339770 TGCACATAGACCTGGAGCCAGGG + Intronic
1104517763 12:129443550-129443572 GAGAGCCAGAACTGGAGCCAGGG - Intronic
1104955327 12:132462071-132462093 CACACTCACACCTGGACCCAAGG + Intergenic
1105258562 13:18761571-18761593 TGCACACAGCAGTGGAGCCATGG + Intergenic
1105261230 13:18780872-18780894 TGCACACAGCAGTGGAGCCATGG + Intergenic
1105263555 13:18797467-18797489 TGCACACAGCAGTGGAGCCATGG + Intergenic
1105542900 13:21330049-21330071 CAGAAACAGAAATTGAGCCAAGG + Intergenic
1106543668 13:30712875-30712897 CAGACACAGGACTGTAGGCAGGG + Intergenic
1106589771 13:31089327-31089349 CACACACAGCTCGGGGGCCAGGG - Intergenic
1106858740 13:33881715-33881737 GACTGAGAGAACTGGAGCCATGG - Intronic
1109178012 13:59179293-59179315 CACACTCAGAACAAGAGCCAAGG + Intergenic
1110545150 13:76747612-76747634 CACACACTGAAATGGAACTATGG + Intergenic
1112336387 13:98520618-98520640 CACACACAACACTGCAGCAACGG + Intronic
1112442355 13:99433596-99433618 CACACACAGAGACAGAGCCACGG - Intergenic
1112505492 13:99972144-99972166 CACACAGAGAAGTGAGGCCAAGG - Intergenic
1113285922 13:108848965-108848987 AGCACACAGATCTGCAGCCAGGG + Intronic
1113323004 13:109255150-109255172 CCCACACAGAATTAGTGCCACGG + Intergenic
1113456779 13:110455047-110455069 CACACACAGCACTGGAGTGGAGG - Intronic
1114329064 14:21617849-21617871 CAGACACAGCACAGAAGCCATGG - Intergenic
1114675679 14:24438802-24438824 CCCACACAGAACAGAACCCAGGG - Exonic
1116824396 14:49657997-49658019 CCCACACAAAACTGGCCCCAGGG + Intronic
1119875211 14:78053695-78053717 CTTGCACAGAACTGGAGCCCAGG - Intergenic
1121254354 14:92520325-92520347 TACACACAGGCCTGGAGCCATGG + Intronic
1122145998 14:99689148-99689170 GACACTCAGATCTGGAGCCCAGG - Intronic
1202834881 14_GL000009v2_random:70573-70595 TGCACACAGCAGTGGAGCCATGG - Intergenic
1202898147 14_GL000194v1_random:21781-21803 CACACACTGGACTCGAACCAGGG + Intergenic
1125538585 15:40456997-40457019 CTCACTCAGAACTGGGGCCCAGG + Intronic
1128666396 15:69541103-69541125 CACACACACAACTTGGGCCCAGG - Intergenic
1128686517 15:69690325-69690347 CAGACACAGGACTGGGGCAAGGG - Intergenic
1128944468 15:71811491-71811513 CACACGCGGCACTGGAGCGAGGG - Exonic
1129513267 15:76140264-76140286 CAGGCACAGGACCGGAGCCAGGG + Intronic
1132021679 15:98367976-98367998 CACACAGAGACCTGAAGACAGGG - Intergenic
1132212488 15:100034697-100034719 CCCAAACAGAACTGGAGAAAGGG + Intronic
1132330775 15:101011073-101011095 CACCCACAGAACTTTACCCAGGG + Intronic
1132606616 16:796310-796332 CCCACATGGAACTGGAGCCGGGG + Intronic
1132801260 16:1755171-1755193 CCAAGACAGACCTGGAGCCATGG + Intronic
1132958644 16:2610202-2610224 CACACCAAGAGCAGGAGCCAAGG - Intergenic
1133864798 16:9632664-9632686 CTCACCCAAAACTGGAGGCAGGG - Intergenic
1136372773 16:29846509-29846531 CATACACAGCACTTGTGCCAAGG - Intronic
1136909400 16:34134022-34134044 CACACAGAGAACAGCCGCCAGGG - Intergenic
1138308775 16:56005321-56005343 CACCCACAGATCTTGAGCCTTGG + Intergenic
1138539433 16:57679450-57679472 CATACACATAATTGGATCCAAGG + Intronic
1138950054 16:61901450-61901472 TACACACAGACCTGGATCCTGGG - Exonic
1139377750 16:66511036-66511058 CACAGACAGTACGGGAGCCTTGG + Exonic
1141924655 16:87160183-87160205 CAAACACAGAAATGTAGCCATGG - Intronic
1142028968 16:87829076-87829098 CTCACACAGATCCTGAGCCAGGG + Intergenic
1143610781 17:8016332-8016354 CAGACACAGAGCAGGAGGCAGGG - Intronic
1144749705 17:17639973-17639995 CACACACAGAAGAGAAGACAGGG + Intergenic
1145210967 17:21012748-21012770 CACACACAGCTCTGGAGACTGGG + Intronic
1145322814 17:21776365-21776387 CACACACAGAGCTGTCTCCAAGG + Intergenic
1147464093 17:40597448-40597470 CACCCCCAGGACAGGAGCCAAGG - Intergenic
1148131132 17:45263194-45263216 CACATAAAGAACTGCAGCCTTGG - Exonic
1149266068 17:54929138-54929160 CACAGACAAAACTCTAGCCAAGG + Intronic
1150308751 17:64109764-64109786 TAGACACAGGACTGGAACCAAGG + Intronic
1150379494 17:64709514-64709536 CACTCCCAGAACTGGAGGCATGG + Intergenic
1152425560 17:80216822-80216844 CACACACAGCAGTGCAGCCAGGG + Intronic
1152535698 17:80949289-80949311 CACCCAGAGATCTGGAACCACGG + Intronic
1153662298 18:7335903-7335925 TACACACAAAAGTGGAGTCATGG + Intergenic
1154424795 18:14263936-14263958 TGCACACAGCAGTGGAGCCATGG - Intergenic
1154430204 18:14302807-14302829 TGCACACAGCAGTGGAGCCATGG - Intergenic
1154432485 18:14319159-14319181 TGCACACAGCAGTGGAGCCATGG - Intergenic
1156292046 18:35755806-35755828 CTCATCCAGAACTGGAACCAAGG - Intergenic
1156893418 18:42215812-42215834 CAGACACAGCACTGAAGCCATGG - Intergenic
1158246009 18:55432506-55432528 CACACACAGAAAGGGAGACTGGG + Intronic
1158559085 18:58498750-58498772 CACAGACAGAATGAGAGCCAAGG - Intronic
1158575216 18:58631481-58631503 CACAAACAGAACATGATCCAGGG + Intergenic
1159848964 18:73503104-73503126 CACACGTAGAACTGGGGACAAGG + Intergenic
1161963002 19:7533257-7533279 CACCTACAGACCTAGAGCCAGGG - Intronic
1162130108 19:8521287-8521309 CACACACAGAAATGGAGAATGGG + Exonic
1162298745 19:9831522-9831544 GACACAAAGAACTGTGGCCAGGG - Intergenic
1162494713 19:11017282-11017304 CACACAAGGAACTGGCCCCAAGG - Intronic
1164042716 19:21507617-21507639 CACAGACAGTACTGGAACCCAGG - Intronic
1164683091 19:30149118-30149140 GTCTCACAGAACTGGAACCATGG + Intergenic
1165108113 19:33486389-33486411 CACACACGGAACTGCTGCCTGGG + Intronic
1166134912 19:40770358-40770380 CACACACAGGCTTGGGGCCAGGG - Intergenic
1166315807 19:41988808-41988830 GACACACAGAACCAGAGACAGGG - Intronic
1166343391 19:42151420-42151442 CAGACAAAGAACTGGAGCCCTGG + Intronic
1166719179 19:44987700-44987722 GAGACACAGAGTTGGAGCCAGGG - Intronic
1166976618 19:46608641-46608663 GACAGGCGGAACTGGAGCCACGG + Intronic
1167278196 19:48551624-48551646 CACAGACAGGGCGGGAGCCAGGG - Intergenic
1167460393 19:49621465-49621487 CTCACAAAGCACTGGGGCCAAGG - Intronic
1168655649 19:58125676-58125698 CACACACAGAGAAGGAGGCATGG + Intergenic
1202637822 1_KI270706v1_random:57119-57141 TGCACACAGCAGTGGAGCCATGG + Intergenic
925416476 2:3673306-3673328 CACAGAGAGATCTGGAGCAAGGG + Intronic
927499094 2:23570483-23570505 CACAAACTTAACTGGAGCCTTGG - Intronic
932427691 2:71651533-71651555 CAAAGAGAGAGCTGGAGCCAGGG + Intronic
932802399 2:74752543-74752565 CACAAATAGAAATGGAGCTAGGG + Intergenic
934793372 2:97081702-97081724 CACACACAGAACCGGGGCATAGG - Intergenic
934900018 2:98152198-98152220 CACACCCAGAACAGGCCCCATGG - Intronic
934928591 2:98400555-98400577 TGCACTCAGAACTGGAGCCAAGG + Intergenic
937368450 2:121281896-121281918 CAAACACAGACTTGAAGCCAAGG - Intronic
937867918 2:126767803-126767825 CACACACAGAGCTGGAGTCATGG + Intergenic
938357804 2:130666078-130666100 CACACTCAGAATTTGTGCCAAGG + Intergenic
938358292 2:130669008-130669030 CACACTCAGAATTTGTGCCAAGG + Intergenic
941593904 2:167452155-167452177 CAGACACAGCACAGAAGCCATGG - Intergenic
941767641 2:169315748-169315770 GATCCACAGAACTGGAGGCAGGG + Intronic
944164343 2:196702329-196702351 CACACACAGCACTTCAGTCAAGG - Intronic
945039864 2:205734564-205734586 GACACACAGATCTGCAGTCAGGG + Intronic
947309209 2:228782031-228782053 CACTCACTGCACTGGAGCCTGGG - Intergenic
947316585 2:228866040-228866062 GACACTCAGTTCTGGAGCCATGG - Intronic
947620841 2:231590043-231590065 CACACACTGAACTCCAGCCAAGG + Intergenic
947795256 2:232890335-232890357 AACCCACAGAGCTGGAGGCATGG - Intronic
948162536 2:235836838-235836860 CACAGACAGAACAGGAGGAACGG + Intronic
948253465 2:236549623-236549645 CACACCCAGAAGTGCAGCCAAGG - Intergenic
948852166 2:240713818-240713840 CACGCACAGTACAGGAGCCTAGG + Exonic
1170048511 20:12113561-12113583 CACAGAGAGAACTGCAGCCCTGG - Intergenic
1170116947 20:12870761-12870783 GACACTGAGAAATGGAGCCAAGG + Intergenic
1171458560 20:25285634-25285656 CACACACAGACATGGAGCAAGGG - Intronic
1171882327 20:30627659-30627681 CACACACAGCAGGGGAGCCCTGG - Intergenic
1172146511 20:32762030-32762052 CACACACAGGCCTGGAGGCGGGG - Intergenic
1173552058 20:43939190-43939212 CACAGACAGAATTGGAACTAAGG - Intronic
1173740098 20:45394303-45394325 TCCACACAGAACTGGAGGCCTGG - Intronic
1174469622 20:50747222-50747244 CACAGAAAGAACTAGAGCCCAGG - Intronic
1176074376 20:63241794-63241816 CACACGCAGACCCTGAGCCAGGG - Intronic
1176161147 20:63649467-63649489 CACAGACACAGCTGGTGCCAGGG + Intronic
1176170931 20:63696107-63696129 CACTCACAGGCCAGGAGCCAGGG - Exonic
1176617831 21:9037770-9037792 CACACACTGGACTCGAACCAGGG + Intergenic
1176706166 21:10121128-10121150 CACACACTGAGCTCGAACCAGGG - Intergenic
1176844553 21:13866590-13866612 TGCACACAGCAGTGGAGCCATGG + Intergenic
1176847286 21:13886153-13886175 TGCACACAGCAGTGGAGCCATGG + Intergenic
1178030061 21:28515163-28515185 CAGACACAGAACTAGTCCCAGGG - Intergenic
1178159456 21:29894799-29894821 CTCAAACAGAAGTGGATCCAGGG - Intronic
1179230892 21:39502880-39502902 CATACACAGAAACAGAGCCAGGG - Intronic
1179275843 21:39891067-39891089 TACAGACAGAAATGGATCCAAGG + Intronic
1179647357 21:42784114-42784136 CTGCCACAGAACTGAAGCCAAGG + Intergenic
1181041993 22:20196646-20196668 CACACACAGAGCCTGAGCCAAGG - Intergenic
1181771171 22:25126724-25126746 CAGACACAGGACTGGAGCTTGGG + Intronic
1181811043 22:25404269-25404291 CACAAACAGAACAGGAGCCCAGG + Intronic
1183185564 22:36289733-36289755 CACACAGAGAACAGATGCCAGGG - Intronic
1183293824 22:37018729-37018751 GACACGCAGAGCTGAAGCCATGG - Exonic
1183351850 22:37338940-37338962 CACACACACAAATTGAGCCTGGG + Intergenic
1183706088 22:39475645-39475667 CAGTCACAGAGCTGGAGCAAGGG - Intronic
1184223468 22:43115359-43115381 CAAACACTGAAGTGGAGCCCAGG + Intronic
1184731962 22:46375443-46375465 GAGACCCAGAACTGAAGCCAGGG - Intronic
1184745239 22:46452272-46452294 CCTACACAGACCTGGAGCCACGG + Intronic
1184748667 22:46471936-46471958 CACACACAGAAATGAAACCACGG - Intronic
1184837417 22:47032153-47032175 CACACGCAGAAGAGGAGCCGTGG - Intronic
1184960971 22:47928162-47928184 CAAACACAGAAGAGGAGCCGGGG - Intergenic
950635620 3:14312316-14312338 CACACACAGGTCTGGAGCCTGGG + Intergenic
951072231 3:18344136-18344158 CACACACAAAAGTAGAGACAAGG - Intronic
951352304 3:21620711-21620733 CACACACCGAACAGGAACAAGGG + Intronic
952045983 3:29320898-29320920 AAAACAGAGTACTGGAGCCATGG - Intronic
953216119 3:40920577-40920599 CACACAAAGACGTGGAGACAAGG + Intergenic
954076384 3:48184550-48184572 CATACACTGGACTGGAGCCCTGG - Intronic
955482321 3:59402233-59402255 CAAAAACGGAACTGGAGCCCAGG - Intergenic
956472233 3:69579403-69579425 CACACACAAAACTGGAAGGAGGG - Intergenic
956760397 3:72438314-72438336 TACACACAGAACTGTAGCCTTGG - Intronic
959449463 3:106481171-106481193 CACACACTGAACTGCCCCCAGGG - Intergenic
960691625 3:120352161-120352183 CATACACAAAACTGGAGCAGAGG + Intergenic
961356115 3:126341047-126341069 CACATAAAGAGCTGGAGCCCAGG + Intergenic
962254649 3:133862045-133862067 TATACACAGAATTGGAGCCCTGG + Intronic
962566701 3:136667788-136667810 AAAACACAGAAATGGGGCCAGGG - Intronic
963552827 3:146745763-146745785 CACGGATAGAAGTGGAGCCATGG - Intergenic
964200047 3:154108845-154108867 CCCACAAAGAAATGGAGGCATGG + Intergenic
967146547 3:186611566-186611588 CACACACAGTTCAGGAGTCAGGG + Intergenic
968449138 4:666952-666974 AACCCACAGAGCTGCAGCCAAGG - Intronic
968494110 4:905957-905979 CACACACAGAGCAGAGGCCAGGG + Intronic
968501582 4:952614-952636 CACACACAGCACAGGACCCCAGG - Intronic
968504484 4:965570-965592 GACACACAGCACTGGGGCCAGGG + Intronic
968698966 4:2045830-2045852 CACACTCAGTCCTGGAGCCATGG + Intergenic
969637715 4:8378977-8378999 CAGCCACTGACCTGGAGCCAGGG - Intronic
970202437 4:13623563-13623585 CACCCAAAGAAATGGAACCATGG - Intronic
970970390 4:21976365-21976387 CAGACACAGAACTGCAGCCAGGG - Intergenic
970976513 4:22048357-22048379 CCAACATAGAGCTGGAGCCATGG - Intergenic
972840246 4:42922253-42922275 CACAGACAGACCAGGAGGCAGGG - Intronic
973365994 4:49210106-49210128 CACACACAGCAGGGGAGCCCTGG - Intergenic
973368050 4:49223484-49223506 TGCACACAGCAGTGGAGCCATGG + Intergenic
973393000 4:49571942-49571964 TGCACACAGCAGTGGAGCCATGG - Intergenic
973394604 4:49582345-49582367 CACACACAGCAGGGGAGCCCTGG + Intergenic
973979131 4:56292101-56292123 CTTACTGAGAACTGGAGCCAAGG + Intronic
974001019 4:56510813-56510835 CACACACTGAACTCCAGCCTGGG - Intronic
974117128 4:57592609-57592631 CACACAAAGAGCTGGGGCCATGG - Intergenic
974399793 4:61388734-61388756 CACACGCAGCAATGAAGCCAGGG - Intronic
974974286 4:68870973-68870995 CACACACACATCTTAAGCCAGGG + Intergenic
976791199 4:88880622-88880644 CAGACACAGCACAGAAGCCATGG + Intronic
977636594 4:99305388-99305410 CAGACACAGGACTGAAGACAGGG - Exonic
979603820 4:122615592-122615614 TACACACACACCTGTAGCCAGGG - Intronic
980025814 4:127765138-127765160 CACCCACAGAACTGAACACAAGG - Intronic
980094207 4:128472848-128472870 AACACACAGCACTGGGGTCAGGG - Intergenic
980407108 4:132367128-132367150 CTCATCAAGAACTGGAGCCAAGG - Intergenic
981816665 4:148838822-148838844 CAGACACAGAACTTGCCCCAGGG + Intergenic
983424742 4:167569071-167569093 CACAAACATAACTGGAATCAGGG + Intergenic
1202765144 4_GL000008v2_random:142976-142998 TGCACACAGCAGTGGAGCCATGG + Intergenic
985575505 5:671776-671798 CAAAGACAGAACTGGCCCCAGGG + Intronic
986288083 5:6375659-6375681 CACACAAAGTCCTGGAGACAAGG + Intronic
987200529 5:15572637-15572659 AAAGCCCAGAACTGGAGCCATGG - Intronic
988031744 5:25771672-25771694 CACACACACAAAGGGGGCCAAGG + Intergenic
988668962 5:33360506-33360528 CACACACAGCACAGGAACCCTGG + Intergenic
989176564 5:38533394-38533416 CACAGGCAGAACTTGAGCCTGGG + Intronic
989781453 5:45269878-45269900 CGTACAAAGAACGGGAGCCAAGG - Intronic
990731924 5:58818213-58818235 CACACCCAGAACAGGAGAGAAGG + Intronic
991021557 5:61984795-61984817 CACACCCAGAACTAGAGGCAAGG + Intergenic
991044808 5:62211444-62211466 CACACACACACCCAGAGCCAAGG + Intergenic
991130277 5:63114959-63114981 TAAACAGAGAACTGGAGGCAAGG + Intergenic
992138082 5:73767979-73768001 CCAACACAGAACTCGGGCCATGG + Intronic
992161986 5:74013103-74013125 CACACACAGACCTGGAGACCTGG + Intergenic
992761685 5:79956116-79956138 AACACAGAGAACTGAAGCCCTGG - Intergenic
996411241 5:123161757-123161779 CTCACACAGAGTTAGAGCCAGGG - Intronic
996634503 5:125673783-125673805 CAGAGACAGAACCTGAGCCAAGG - Intergenic
997414406 5:133713965-133713987 GAGACACAGAGCTGCAGCCAGGG + Intergenic
997646650 5:135486538-135486560 CACAGCCAGAAATGGAGCCTGGG - Intergenic
997779276 5:136640666-136640688 CACAGAAAGAGCTGGATCCATGG + Intergenic
999480506 5:151943791-151943813 CACTCACAGACTTGGAGCAAAGG - Intergenic
1001081280 5:168669433-168669455 CCTACAGAGAACTGCAGCCATGG + Intronic
1002328535 5:178425950-178425972 CACACCCAGAAAAGGTGCCACGG + Intronic
1002763474 6:219305-219327 CAGAAGCAGAGCTGGAGCCAAGG + Intergenic
1002830657 6:817466-817488 CACACACACACGTAGAGCCAGGG - Intergenic
1006821913 6:36903211-36903233 CACACACAAAATTGGAGGCAGGG - Intronic
1008002030 6:46370696-46370718 CACACACTGAAATGCAGGCAGGG - Intronic
1008231169 6:48986484-48986506 CAGACACAGCACAGAAGCCATGG + Intergenic
1009818281 6:68765567-68765589 CACACACACACCTGGAGCAGAGG + Intronic
1009848640 6:69166592-69166614 AACACACAGAATTGGAGCTGTGG + Intronic
1010204049 6:73307570-73307592 CACAAACAGAACTGGGGTCTTGG + Intronic
1012373039 6:98529980-98530002 CACACACACAACGAGAGCAAAGG + Intergenic
1015105857 6:129535941-129535963 CACACATAGAACTGGAAAGATGG + Intergenic
1015708459 6:136113622-136113644 AACACAGAGAACTGGAGGGACGG + Intronic
1017124885 6:151056230-151056252 CAAACACAGAACAACAGCCAGGG - Intronic
1017235438 6:152113093-152113115 GACACACAGCACTGGCGGCAGGG - Intronic
1017333222 6:153223979-153224001 CACACACAGAAGAGAGGCCATGG + Intergenic
1017490617 6:154941558-154941580 CAAACGCAGAACTGGTGTCATGG + Intronic
1017525401 6:155237712-155237734 CCAACACAGAGCTTGAGCCATGG - Intronic
1017840006 6:158213923-158213945 CAGACTCAGAATTTGAGCCAAGG - Intergenic
1018379342 6:163243559-163243581 CACACACACAGCAGGAGCCGCGG + Intronic
1018849187 6:167575568-167575590 CACACACAGTTCTGGAGGCTGGG - Intergenic
1019414491 7:921014-921036 CACACACACACCTGGGGCCAGGG - Intronic
1019899951 7:4012458-4012480 CACACACAAAACTGGTGTCAGGG + Intronic
1019949758 7:4361893-4361915 CACACACAGTGATGGAACCATGG + Intergenic
1021193719 7:17651112-17651134 CAAACTGACAACTGGAGCCAGGG + Intergenic
1021498127 7:21298722-21298744 CACAGACACCCCTGGAGCCATGG + Intergenic
1021718764 7:23486098-23486120 CACACACAAAACAGGCACCAGGG - Intergenic
1022184992 7:27958657-27958679 GTCACACAGAACTGGACCCCTGG - Intronic
1023890317 7:44387202-44387224 CACACACTGCACTGTAGCCTTGG - Intronic
1024247080 7:47478948-47478970 CACACACAGAGCAGCAGCAAGGG + Intronic
1026982708 7:74536084-74536106 CACACACAGACCTTTACCCAGGG + Intronic
1028296787 7:89142834-89142856 CATCCACAGAACTGGAGCATTGG + Intronic
1029582723 7:101448036-101448058 CAAAAACAGCACTGGTGCCAGGG + Intronic
1032000410 7:128261546-128261568 CACACACAGAACTGGCTCCAGGG + Intergenic
1032769889 7:135040898-135040920 CACACACAAAACTAGAACAAGGG + Intronic
1034411525 7:150944816-150944838 CACACCCAGACCTGGATACAGGG + Intergenic
1034469862 7:151249265-151249287 CACACACAGCAGTGGACGCAGGG - Intronic
1034561544 7:151882966-151882988 CACGCAGAGAAGTGGAGGCAGGG + Intergenic
1034879099 7:154750106-154750128 CACACACAGGCCAGGAGCAAGGG - Intronic
1035346222 7:158201092-158201114 CACACACAGCACTCTAGCCTGGG - Intronic
1035436429 7:158863564-158863586 CTCACACACACCTGGAGCTAAGG - Intronic
1035436583 7:158864060-158864082 CACACACACACCGGGAGCTAAGG - Intronic
1036967772 8:13319661-13319683 CACACACTGAACAGGAAGCATGG - Intronic
1038521996 8:28241907-28241929 CAGACACAGAATCGTAGCCAAGG - Intergenic
1038632347 8:29258083-29258105 CACTGACAGATGTGGAGCCAAGG - Intronic
1039459146 8:37728859-37728881 CCCATACAGAACTGTACCCATGG + Intergenic
1040471104 8:47736786-47736808 CACACACACACCTGGCGCCCGGG + Intergenic
1041401619 8:57451258-57451280 CAGGCACAGAACAGGAGCCATGG + Intergenic
1043267213 8:78281232-78281254 CAGAAGCAGAACTTGAGCCAAGG - Intergenic
1045346306 8:101296955-101296977 CACACACACACCTGGTGCCTTGG + Intergenic
1046788870 8:118299069-118299091 CACACACAGAAGTGGACAAAAGG - Intronic
1048532044 8:135258662-135258684 CACACACAGAAAATGAGCAAAGG + Intergenic
1049338593 8:142099919-142099941 CACACCCAGGACTGGAGCCCAGG - Intergenic
1049938330 9:520814-520836 AAAATACAGATCTGGAGCCATGG - Intronic
1050133658 9:2439515-2439537 CAGACACAGCACAGAAGCCATGG - Intergenic
1054350251 9:64013759-64013781 CACACACTGGACTCGAACCAAGG + Intergenic
1054540072 9:66263332-66263354 CACACACTGGACTCGAACCAGGG + Intergenic
1056625928 9:88253019-88253041 CACAGACTGTACTGGAGGCATGG - Intergenic
1057478967 9:95429135-95429157 CACAGACTGAACAGGAGGCATGG - Intergenic
1058803732 9:108569677-108569699 CAGGCACAGACCTGGGGCCATGG - Intergenic
1060518724 9:124281956-124281978 CAGACACAGAAGTGGAGCCCGGG + Intronic
1060593721 9:124835284-124835306 TACACCCAGACCTGGAGCCTGGG - Intergenic
1061192263 9:129088729-129088751 CAATCCCAGAAGTGGAGCCAGGG - Intronic
1061363951 9:130160852-130160874 CACACACTGCACTGCAGCCTAGG - Intergenic
1061897217 9:133654766-133654788 CACACAGCGAACAGGAGGCAGGG + Intronic
1062281790 9:135755117-135755139 CACCCACAGAATAGGAGCCCTGG - Exonic
1062710977 9:137975046-137975068 CTCACCCAGCTCTGGAGCCACGG + Intronic
1062718483 9:138022917-138022939 CACACACAGCAATGGAGTAATGG - Intronic
1203545892 Un_KI270743v1:127865-127887 TGCACACAGCAGTGGAGCCATGG + Intergenic
1185744786 X:2563995-2564017 CACACACTGCACTGCAGCCTGGG - Intergenic
1185816710 X:3163118-3163140 CACCCGAAGGACTGGAGCCAGGG + Intergenic
1186534201 X:10330058-10330080 CACACAAAGAAAAAGAGCCATGG + Intergenic
1186963017 X:14757860-14757882 CAGACACAGCACAGAAGCCACGG + Intergenic
1187263224 X:17706516-17706538 CACACACACAGTTGGCGCCATGG + Intronic
1187792722 X:22968498-22968520 CACACACAGACTTAGAGGCAGGG + Intergenic
1188335468 X:28926932-28926954 CACACACTGAACTCCAGCCTGGG - Intronic
1189720009 X:43906162-43906184 AACACAGAGAGCTGGACCCAAGG + Intergenic
1191255172 X:58276573-58276595 CGCACCCAGAGTTGGAGCCAGGG + Intergenic
1192955899 X:76069581-76069603 CACCCACAGAACTGCAGCTGAGG + Intergenic
1195229400 X:102830902-102830924 CACACAAACTAATGGAGCCAGGG - Intergenic
1195872867 X:109504305-109504327 CACATCCAGAACTGGAGCTGTGG + Intergenic
1195891085 X:109695853-109695875 CATACCCAAAACTGGAGTCAGGG - Intronic
1196057065 X:111367304-111367326 GACACAAGGAAATGGAGCCAAGG + Intronic
1196169034 X:112566692-112566714 CACAGACAGTACAGGAGACATGG + Intergenic
1196816303 X:119667669-119667691 CACACTCAGTACTGGGCCCAGGG - Intronic
1198423156 X:136487944-136487966 GACACACAGAACTGAAGCAAAGG + Exonic
1198595280 X:138229323-138229345 CAGAGCTAGAACTGGAGCCAAGG - Intergenic
1198763661 X:140059764-140059786 CACACCCAGAACTGGGCCCTAGG - Intergenic
1199041535 X:143120184-143120206 CTCACTGCGAACTGGAGCCAAGG - Intergenic
1199299611 X:146197669-146197691 CACAGGAAAAACTGGAGCCAGGG - Intergenic
1199753838 X:150846273-150846295 CACACACACAATTGGGGCCAAGG + Intronic
1199847843 X:151703797-151703819 CACCCACAGAACAGAAGCCTGGG - Exonic
1199985252 X:152945580-152945602 CACTCACAGAACAGGAGCCTGGG - Intronic
1200210091 X:154343204-154343226 CACACACAGAGCCGGACACACGG - Intergenic
1200220761 X:154388888-154388910 CACACACAGAGCCGGACACACGG + Intergenic