ID: 1067568830

View in Genome Browser
Species Human (GRCh38)
Location 10:47357156-47357178
Sequence GGTGAACTCCTCCGCGGTGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 42
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 40}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067568830_1067568837 2 Left 1067568830 10:47357156-47357178 CCGGCACCGCGGAGGAGTTCACC 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1067568837 10:47357181-47357203 TATCATGAAGAGGCTGGGCCGGG 0: 1
1: 0
2: 1
3: 38
4: 397
1067568830_1067568838 8 Left 1067568830 10:47357156-47357178 CCGGCACCGCGGAGGAGTTCACC 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1067568838 10:47357187-47357209 GAAGAGGCTGGGCCGGGCCCTGG 0: 1
1: 1
2: 6
3: 83
4: 690
1067568830_1067568841 17 Left 1067568830 10:47357156-47357178 CCGGCACCGCGGAGGAGTTCACC 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1067568841 10:47357196-47357218 GGGCCGGGCCCTGGTCATTGGGG 0: 1
1: 0
2: 0
3: 9
4: 167
1067568830_1067568846 30 Left 1067568830 10:47357156-47357178 CCGGCACCGCGGAGGAGTTCACC 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1067568846 10:47357209-47357231 GTCATTGGGGAGGTGACCAGTGG 0: 1
1: 0
2: 2
3: 7
4: 240
1067568830_1067568832 -8 Left 1067568830 10:47357156-47357178 CCGGCACCGCGGAGGAGTTCACC 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1067568832 10:47357171-47357193 AGTTCACCTATATCATGAAGAGG 0: 1
1: 0
2: 0
3: 5
4: 86
1067568830_1067568843 20 Left 1067568830 10:47357156-47357178 CCGGCACCGCGGAGGAGTTCACC 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1067568843 10:47357199-47357221 CCGGGCCCTGGTCATTGGGGAGG 0: 1
1: 0
2: 1
3: 19
4: 120
1067568830_1067568833 -4 Left 1067568830 10:47357156-47357178 CCGGCACCGCGGAGGAGTTCACC 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1067568833 10:47357175-47357197 CACCTATATCATGAAGAGGCTGG 0: 1
1: 0
2: 1
3: 11
4: 112
1067568830_1067568840 16 Left 1067568830 10:47357156-47357178 CCGGCACCGCGGAGGAGTTCACC 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1067568840 10:47357195-47357217 TGGGCCGGGCCCTGGTCATTGGG 0: 1
1: 0
2: 0
3: 10
4: 122
1067568830_1067568836 1 Left 1067568830 10:47357156-47357178 CCGGCACCGCGGAGGAGTTCACC 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1067568836 10:47357180-47357202 ATATCATGAAGAGGCTGGGCCGG 0: 1
1: 0
2: 0
3: 17
4: 192
1067568830_1067568839 15 Left 1067568830 10:47357156-47357178 CCGGCACCGCGGAGGAGTTCACC 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1067568839 10:47357194-47357216 CTGGGCCGGGCCCTGGTCATTGG 0: 1
1: 0
2: 0
3: 24
4: 248
1067568830_1067568834 -3 Left 1067568830 10:47357156-47357178 CCGGCACCGCGGAGGAGTTCACC 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1067568834 10:47357176-47357198 ACCTATATCATGAAGAGGCTGGG 0: 1
1: 0
2: 1
3: 4
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067568830 Original CRISPR GGTGAACTCCTCCGCGGTGC CGG (reversed) Exonic
903455457 1:23484077-23484099 GCTGAGGTCCTCCGCGGTGACGG + Exonic
904336297 1:29800468-29800490 GGTGAACTCCTCCACAGCCCCGG - Intergenic
1067567638 10:47350121-47350143 GGCGAACTCCTCCGCGGCCGTGG - Exonic
1067568830 10:47357156-47357178 GGTGAACTCCTCCGCGGTGCCGG - Exonic
1103359906 12:120347424-120347446 GGTGAGCTCTTCTGAGGTGCAGG - Exonic
1118872201 14:69752808-69752830 GGTGAACTCTCCCGTGGTCCAGG - Intronic
1121662464 14:95645771-95645793 GGTGAACTCCTCCCTGCTTCTGG + Intergenic
1121733515 14:96202632-96202654 GGTAAACTCCTCCGAGGCACGGG + Intergenic
1122250501 14:100435955-100435977 AGTCAACTCTTCCACGGTGCTGG - Intronic
1132160427 15:99536539-99536561 GGTGGACTCCTCAGCAGTGGGGG - Intergenic
1132518708 16:377673-377695 GGTGATCTCCGCGTCGGTGCAGG + Exonic
1134633738 16:15776796-15776818 GGAGAGCTTCTCCGCGATGCGGG + Intronic
1142395209 16:89828214-89828236 TGCGAACCCCTCCGGGGTGCTGG - Intronic
1161017536 19:1990730-1990752 GGTGAAGCCCTCCGCGGTGATGG + Exonic
1161233260 19:3186149-3186171 GGTGAACTCGTGCGCGGCGTCGG - Exonic
1168492807 19:56824398-56824420 GATGATCTCCTCCTTGGTGCGGG + Exonic
925411421 2:3641974-3641996 GGTCATCGCCTCCGTGGTGCCGG - Intronic
925996129 2:9294789-9294811 GGTGTCCTCCTTCACGGTGCTGG - Intronic
934484520 2:94691454-94691476 AGAGAACACCTCGGCGGTGCAGG + Intergenic
947903688 2:233743892-233743914 GGTGGACTACTACGAGGTGCTGG - Intronic
1185069813 22:48649788-48649810 TGTGAACTCCTTGGCCGTGCAGG - Intronic
950457116 3:13099474-13099496 GGTGGACTCCTCCCCCGAGCTGG + Intergenic
952878812 3:37970217-37970239 GGTGAACTCCTTCAAGGTCCAGG + Intronic
968943153 4:3649825-3649847 GGTGAGCTCCGCCTCGATGCAGG - Intergenic
986104183 5:4644132-4644154 GGGGAACGCCTCTGCTGTGCGGG - Intergenic
995854098 5:116574716-116574738 GCGGCGCTCCTCCGCGGTGCCGG - Exonic
1007485616 6:42178836-42178858 GGTGAACTCCTCTGCAGTCATGG - Exonic
1007826564 6:44605397-44605419 GGTGAGCTCCTCCTGGGTGTTGG + Intergenic
1007982202 6:46170922-46170944 GGTGAGCTCCTGCGCGTTCCGGG - Exonic
1019055766 6:169222247-169222269 GGTGAACTCCACCACGGGGACGG - Exonic
1019354126 7:570125-570147 GGTGAGATCCGCCGAGGTGCCGG - Intronic
1025015967 7:55439393-55439415 GGTGAACTCCTCGGCAGCACAGG + Intronic
1026011666 7:66640973-66640995 GCTGAATTCCTCCGTGGGGCTGG + Exonic
1032119333 7:129145006-129145028 GGAGAACTCCTCCCCGGAGGCGG - Exonic
1036653826 8:10662806-10662828 GGTGTACTCCTCCCCTGTCCTGG + Intronic
1038591137 8:28839031-28839053 GGTTAGCTCCTCCACGGTGGAGG - Intronic
1053673274 9:40392943-40392965 AGAGAACACCTCGGCGGTGCAGG - Intergenic
1054384378 9:64533009-64533031 AGAGAACACCTCGGCGGTGCAGG - Intergenic
1054511353 9:65983344-65983366 AGAGAACACCTCGGCGGTGCAGG + Intergenic
1060970035 9:127732576-127732598 GGTCATCTCCCGCGCGGTGCTGG - Exonic
1190333962 X:49251642-49251664 GGTGAGCTCCTCTGAGGTGGCGG - Exonic
1196684169 X:118496267-118496289 GGCGCACGCCTCCGCCGTGCCGG - Intronic