ID: 1067569566

View in Genome Browser
Species Human (GRCh38)
Location 10:47361434-47361456
Sequence GGCCAGAGTAGCCCCCAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067569566_1067569568 -3 Left 1067569566 10:47361434-47361456 CCGGCCTGGGGGCTACTCTGGCC No data
Right 1067569568 10:47361454-47361476 GCCGACTTTCACCCCTGATAAGG No data
1067569566_1067569574 19 Left 1067569566 10:47361434-47361456 CCGGCCTGGGGGCTACTCTGGCC No data
Right 1067569574 10:47361476-47361498 GGCTCTCTCTCCGTGCTCACAGG No data
1067569566_1067569578 29 Left 1067569566 10:47361434-47361456 CCGGCCTGGGGGCTACTCTGGCC No data
Right 1067569578 10:47361486-47361508 CCGTGCTCACAGGAACAGGGTGG No data
1067569566_1067569575 25 Left 1067569566 10:47361434-47361456 CCGGCCTGGGGGCTACTCTGGCC No data
Right 1067569575 10:47361482-47361504 CTCTCCGTGCTCACAGGAACAGG No data
1067569566_1067569576 26 Left 1067569566 10:47361434-47361456 CCGGCCTGGGGGCTACTCTGGCC No data
Right 1067569576 10:47361483-47361505 TCTCCGTGCTCACAGGAACAGGG No data
1067569566_1067569570 -2 Left 1067569566 10:47361434-47361456 CCGGCCTGGGGGCTACTCTGGCC No data
Right 1067569570 10:47361455-47361477 CCGACTTTCACCCCTGATAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067569566 Original CRISPR GGCCAGAGTAGCCCCCAGGC CGG (reversed) Intergenic
No off target data available for this crispr