ID: 1067571376

View in Genome Browser
Species Human (GRCh38)
Location 10:47373824-47373846
Sequence CTGAATAAACGCAGGCAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067571373_1067571376 29 Left 1067571373 10:47373772-47373794 CCTAACTAAAATAGTTGCATTCT 0: 1
1: 1
2: 0
3: 22
4: 273
Right 1067571376 10:47373824-47373846 CTGAATAAACGCAGGCAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067571376 Original CRISPR CTGAATAAACGCAGGCAGCA TGG Intronic
No off target data available for this crispr